ID: 1114228132

View in Genome Browser
Species Human (GRCh38)
Location 14:20757209-20757231
Sequence ACAGTATTGTAGGCCTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114228132_1114228136 10 Left 1114228132 14:20757209-20757231 CCTCACCAGGCCTACAATACTGT No data
Right 1114228136 14:20757242-20757264 TACAGATTAGGTGATGAATTTGG No data
1114228132_1114228135 -2 Left 1114228132 14:20757209-20757231 CCTCACCAGGCCTACAATACTGT No data
Right 1114228135 14:20757230-20757252 GTTTAGACTTCTTACAGATTAGG No data
1114228132_1114228137 22 Left 1114228132 14:20757209-20757231 CCTCACCAGGCCTACAATACTGT No data
Right 1114228137 14:20757254-20757276 GATGAATTTGGCCTCTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114228132 Original CRISPR ACAGTATTGTAGGCCTGGTG AGG (reversed) Intergenic
No off target data available for this crispr