ID: 1114232834

View in Genome Browser
Species Human (GRCh38)
Location 14:20799711-20799733
Sequence CCTTTTAAGCATTTTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114232834_1114232842 29 Left 1114232834 14:20799711-20799733 CCTGCCTCAAAATGCTTAAAAGG No data
Right 1114232842 14:20799763-20799785 CTTTTAGGACACAAGTCCGCTGG No data
1114232834_1114232838 -1 Left 1114232834 14:20799711-20799733 CCTGCCTCAAAATGCTTAAAAGG No data
Right 1114232838 14:20799733-20799755 GGACTCATTTTCTTTGTTCTTGG No data
1114232834_1114232839 0 Left 1114232834 14:20799711-20799733 CCTGCCTCAAAATGCTTAAAAGG No data
Right 1114232839 14:20799734-20799756 GACTCATTTTCTTTGTTCTTGGG No data
1114232834_1114232840 14 Left 1114232834 14:20799711-20799733 CCTGCCTCAAAATGCTTAAAAGG No data
Right 1114232840 14:20799748-20799770 GTTCTTGGGCTCAGCCTTTTAGG No data
1114232834_1114232843 30 Left 1114232834 14:20799711-20799733 CCTGCCTCAAAATGCTTAAAAGG No data
Right 1114232843 14:20799764-20799786 TTTTAGGACACAAGTCCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114232834 Original CRISPR CCTTTTAAGCATTTTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr