ID: 1114233257

View in Genome Browser
Species Human (GRCh38)
Location 14:20802578-20802600
Sequence AGAAGGAGCCTCCAAATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114233257_1114233261 -8 Left 1114233257 14:20802578-20802600 CCCCCAATTTGGAGGCTCCTTCT 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1114233261 14:20802593-20802615 CTCCTTCTTCTCCAGTCCCATGG 0: 1
1: 0
2: 3
3: 47
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114233257 Original CRISPR AGAAGGAGCCTCCAAATTGG GGG (reversed) Intronic
901242466 1:7703612-7703634 AAAAGGTGTCTCGAAATTGGGGG - Intronic
902702671 1:18183262-18183284 AGATGGTGCCTCAAAATTTGTGG - Intronic
902804161 1:18850524-18850546 AGAAGGAGGCTCCAACCAGGTGG + Intronic
903840666 1:26236960-26236982 AGATGAAGCCTCCAAATAGTAGG + Intronic
903862762 1:26374796-26374818 AGGAGGTGCCTCCACATTAGGGG + Intergenic
905029000 1:34868962-34868984 GGAAGGAGCGTCCAAACTGCAGG + Exonic
905195226 1:36271296-36271318 AGAATGAGACTCCATCTTGGGGG - Intronic
908385738 1:63639825-63639847 AGAATGAGCTGCTAAATTGGAGG + Intronic
912496237 1:110093927-110093949 AGGAGGAGGCTCCAAGTTGCTGG + Intergenic
913685606 1:121228895-121228917 AGAGGGAGCCTCCATACTGTGGG + Intronic
916022142 1:160802109-160802131 ACCAGGAGTCTCCAAGTTGGCGG - Intronic
916126186 1:161573594-161573616 AGAACTACCCTTCAAATTGGAGG + Intergenic
916136104 1:161655434-161655456 AGAACTACCCTTCAAATTGGAGG + Intronic
916510058 1:165465452-165465474 AAGAGGAGCCTTCAAATTGATGG - Intergenic
916664126 1:166950121-166950143 AGAAGTAGCCTCCAAATTTATGG + Intronic
916801344 1:168219490-168219512 AGATGAAGCCTCCAAGTAGGAGG + Intergenic
920472925 1:206247452-206247474 AGAGGGAGCCTCCATACTGTGGG + Intronic
921614274 1:217248332-217248354 AGAAGGAGCCCCCAAAAAGCTGG - Intergenic
921634405 1:217475978-217476000 AGAACGAGCCTGAAAAATGGAGG + Intronic
921761024 1:218915111-218915133 AGAAGAAGACTCCATCTTGGGGG + Intergenic
922284611 1:224158667-224158689 AGAAAGAGCCTTGAAATTTGGGG - Exonic
924042439 1:239997564-239997586 AGAAGACGCCGCCAAATTAGAGG - Intergenic
1063224329 10:4001297-4001319 AGAAGGAGCAAGAAAATTGGGGG - Intergenic
1063490566 10:6459823-6459845 AGAATAAGCCACCAAATTTGGGG + Intronic
1065381405 10:25095359-25095381 AGAAAGAGACTCCAAATTTCAGG - Intergenic
1070018180 10:72556157-72556179 AGAGGGAGTCTCGAAAATGGAGG - Intronic
1070396777 10:76018021-76018043 GGAAGGAGCCCCCACAGTGGTGG - Intronic
1070490789 10:76974503-76974525 AGAAGGAGACTCCCAATTCTCGG - Intronic
1072428344 10:95349404-95349426 AGAAGGAGACTCTAAAATGATGG - Intronic
1073203511 10:101755306-101755328 AGAAGGAGCCCCCAAAGTTTTGG + Intergenic
1073244459 10:102079733-102079755 ACAAGGAGCCTCCAGTTTGATGG - Intergenic
1074681681 10:115913700-115913722 AGAAGCAGCCTCCAGAGTGTAGG + Intronic
1081679520 11:44991966-44991988 GGAGGGAGCCTCCAAATGGTAGG + Intergenic
1082930688 11:58601935-58601957 AGAACGAGACTCCATCTTGGGGG - Intronic
1083180442 11:60981733-60981755 TGCAGGAGCCTACAAAATGGAGG - Intronic
1085931370 11:81087496-81087518 AGAAGCAAGCTCCACATTGGTGG - Intergenic
1086297228 11:85383905-85383927 AGAAGGGCACTCCAAATAGGTGG - Intronic
1086607278 11:88710816-88710838 AGAAGGTGCATCCAAGTTTGAGG + Intronic
1088432871 11:109777775-109777797 ACAAGCAGCCCCCAAATTAGTGG - Intergenic
1090857771 11:130625246-130625268 AGAAGGAGCCGGCAGCTTGGAGG - Intergenic
1092721999 12:11450565-11450587 AGATGAAGCCTCCAAGTAGGAGG + Intronic
1094872479 12:34606025-34606047 AGAGGAAGCCTTGAAATTGGAGG + Intergenic
1095978628 12:47957408-47957430 AGAGTGAGACTCCAACTTGGTGG + Intergenic
1097581641 12:61464620-61464642 ATAATGGGCATCCAAATTGGAGG + Intergenic
1098953159 12:76662633-76662655 AGCAGGAGTCTCAGAATTGGTGG + Intergenic
1099301171 12:80896184-80896206 AGAAGGAGCATCCAGACAGGAGG + Intronic
1104579661 12:130001478-130001500 AGCAGGAGCCTCCTAAGAGGAGG - Intergenic
1108753275 13:53470736-53470758 AGAAGGGGGCACCAAATGGGGGG + Intergenic
1109262463 13:60160402-60160424 AAAGGGAGCCTGTAAATTGGTGG - Intronic
1112212085 13:97387899-97387921 AGAAACAGCCACCACATTGGGGG - Intronic
1114233257 14:20802578-20802600 AGAAGGAGCCTCCAAATTGGGGG - Intronic
1117773462 14:59157919-59157941 TGTAGGAGCCTTTAAATTGGAGG + Intergenic
1119834929 14:77740654-77740676 AGAAGAAGCCTCGATAATGGAGG - Intronic
1124356725 15:29000940-29000962 AGAAGGAGCCTCCCATGTGAAGG - Intronic
1126905068 15:53356186-53356208 AGAGTGAGGCTCCAAATTTGAGG - Intergenic
1126920301 15:53513990-53514012 AGAAGGAGCCTACAGATGGCAGG - Exonic
1126969809 15:54098139-54098161 AGAGGGAGTCACCAAAGTGGAGG - Intronic
1128902640 15:71438637-71438659 AGAGGGAGCCTCAAAATAGTGGG - Intronic
1130751189 15:86714849-86714871 ACAAGGAAGCTCCAAATAGGAGG - Intronic
1132380781 15:101364858-101364880 AGAAAGAACCACCAAGTTGGAGG + Intronic
1134132463 16:11659040-11659062 AGAAGGAGCCTGCAAGGAGGGGG + Intergenic
1136002464 16:27305189-27305211 AAAAATAGCCCCCAAATTGGAGG - Intergenic
1138499688 16:57432322-57432344 AGAAGGAAACTCCATGTTGGTGG - Intronic
1139966675 16:70749666-70749688 AGAAGGGGCCACCAAGATGGAGG + Intronic
1141932584 16:87216017-87216039 AGTCTGAGCCTCCAGATTGGGGG - Intronic
1142382158 16:89739074-89739096 AGAAGGAGCCTCCGGCTGGGGGG + Intronic
1144039984 17:11402163-11402185 ATAAGGAACCTCCTAAATGGTGG - Intronic
1144681716 17:17200381-17200403 GGAAGGAGCCTGCACACTGGGGG - Intronic
1144943694 17:18959128-18959150 AGAGGGAGGCTCCAATCTGGAGG - Exonic
1145261726 17:21358612-21358634 AGAAGGAGCCTACCAAGTGGAGG + Intergenic
1151397570 17:73834052-73834074 AGCAGGAGCCTCAAAAATGCTGG + Intergenic
1151978931 17:77497909-77497931 AGGAGGGGCCTCCAGGTTGGCGG + Intronic
1152427454 17:80225938-80225960 AGAAGGAGCTTCCTTATAGGAGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153287456 18:3469556-3469578 AGAAGGAGAAAGCAAATTGGAGG - Intergenic
1153987379 18:10365263-10365285 AGAAGCAGCCTCCACATATGAGG + Intergenic
1157479737 18:48045680-48045702 AGATGGAGCCTCTGAATTGAGGG - Intronic
1158975102 18:62703986-62704008 AGACTGTGGCTCCAAATTGGTGG - Intergenic
1161829967 19:6595599-6595621 AGAAGGAGCCTCAAACCTGGAGG + Intronic
1166863632 19:45823485-45823507 AGCAGGAGGCACCAAGTTGGAGG + Intronic
1168531671 19:57134818-57134840 AAAAATAGCCTCCAAATTAGAGG + Exonic
928017921 2:27676223-27676245 AGAAGTAGACTCTCAATTGGTGG + Intronic
929301183 2:40305183-40305205 AGAAGGGGCTTCCCAAGTGGTGG - Intronic
929461581 2:42105927-42105949 GGGAGGAGCCTCCAAATTGGGGG - Intergenic
930725434 2:54677123-54677145 AGAAGGACCCTCCAAACAGCTGG + Intergenic
930806990 2:55500719-55500741 ACAAGGATCCTTCAAAGTGGAGG - Intergenic
934105416 2:88691078-88691100 AGAACCAGTCTCCAAATGGGCGG + Intergenic
935879010 2:107542520-107542542 AGAAGGAGTCTCAAAATTCACGG + Intergenic
937842304 2:126535877-126535899 ACATGGAGTCTCCAAATTGTGGG + Intergenic
938307212 2:130264356-130264378 AGATGGTGTCTCCATATTGGGGG - Intergenic
939164015 2:138620862-138620884 AGAATGAGCCTCCAGATAGCAGG - Intergenic
941175580 2:162194128-162194150 GGAAAGAGCCTCCAAATTTCAGG + Intronic
942109473 2:172665989-172666011 AGTAGGAGCCTGCATATTTGAGG + Intergenic
943734547 2:191339987-191340009 AGAGAGACCCTCCAACTTGGAGG + Intronic
947076665 2:226352282-226352304 ATAAGAAGAATCCAAATTGGTGG + Intergenic
1168884864 20:1242037-1242059 TTAAGGAACCTCCAAATTGGTGG + Intronic
1169520853 20:6371507-6371529 AGATGGAAGCTCCAAATGGGAGG + Intergenic
1171223661 20:23422610-23422632 AGAAGGAGGCGGGAAATTGGAGG + Intergenic
1171249773 20:23638436-23638458 AGAAGGAGCCTGAAGAGTGGCGG - Intronic
1171820384 20:29831200-29831222 AGAAGGAGCAGCCAAAGAGGTGG + Intergenic
1172824190 20:37766559-37766581 AGGAAGAGCCTCCAAATTGCTGG + Intronic
1172934160 20:38607636-38607658 AGAAGCGGCCTCCACATTGCAGG - Intronic
1177318513 21:19492037-19492059 AGCATGAGCTTCCAAATTTGGGG - Intergenic
1177827614 21:26101808-26101830 AGAATGAGGTTGCAAATTGGAGG - Intronic
1178247477 21:30967898-30967920 AGATGAAGCCTCCAAATAGCAGG + Intergenic
1180324384 22:11355905-11355927 AGAAGGAGCAGCCAAAGAGGTGG + Intergenic
1181808735 22:25390913-25390935 AGAAGGGGCCTCTGAAGTGGAGG - Intronic
1184432508 22:44449775-44449797 AGAAAGAGCCTCCAGCGTGGGGG - Intergenic
950930298 3:16782648-16782670 GGAAGGAACTTCCAAACTGGAGG - Intergenic
950931540 3:16793602-16793624 AGCAGGAGCTTCCAAAGTGGGGG + Intergenic
951469827 3:23044259-23044281 AGATGGAGACCCCAATTTGGAGG - Intergenic
952082138 3:29772035-29772057 AGAAGCATCCTCAAAAGTGGAGG + Intronic
952548113 3:34444912-34444934 ACAGGGAGCCTACAAAATGGGGG - Intergenic
952667453 3:35923368-35923390 TGAAGGATCCTCCAGATTGCAGG - Intergenic
954651941 3:52170315-52170337 TGAAGGAGCCTCAATGTTGGGGG + Intergenic
960173649 3:114492064-114492086 AGAAGGAGCCACCAAGAAGGTGG - Intronic
961014127 3:123454379-123454401 ATAAGGAGCCCCCAAATTTAGGG + Intergenic
961668214 3:128507229-128507251 GAGAGGAGCCTCCCAATTGGAGG + Intergenic
961854502 3:129856314-129856336 CGAAGGGACCTCCAAATTTGTGG + Intronic
964718372 3:159746818-159746840 AGAAGGATATTCCAATTTGGGGG - Intronic
969057824 4:4413284-4413306 AGAAGGATGGTCCACATTGGAGG + Intronic
970202106 4:13620507-13620529 TTAGTGAGCCTCCAAATTGGTGG + Intronic
971886957 4:32462950-32462972 AGAAGGAGCCTTCCTGTTGGGGG - Intergenic
973971452 4:56217585-56217607 AGATGGAGCCTCCAGATAGCAGG + Intronic
981198236 4:141945315-141945337 ATAAAGAGCATCCAAATAGGAGG - Intergenic
981500985 4:145451575-145451597 GAAAGGAGCCTTCAAATAGGTGG + Intergenic
981828098 4:148967949-148967971 AGAAAGAGCTTCCAAAGTCGGGG - Intergenic
981851627 4:149237978-149238000 ATAAAGTGACTCCAAATTGGTGG - Intergenic
984985833 4:185328887-185328909 AGGAGGGGCCACCAGATTGGAGG + Intronic
987503923 5:18746039-18746061 AGAAGTATCCTCCCAATTGAAGG + Intergenic
990342183 5:54834457-54834479 AAATGGAGCCTCCAAATTGAAGG - Intergenic
993627979 5:90249021-90249043 AGATGATGCCACCAAATTGGAGG - Intergenic
996384751 5:122899490-122899512 AGATGGAGCCTGCGAATTCGAGG - Intronic
1001069567 5:168573157-168573179 AGAAGGAGCCTGCAATTTTCTGG - Intronic
1002719867 5:181251975-181251997 AGCTGGAGCCTCAAAATAGGAGG - Intergenic
1003321376 6:5055046-5055068 AGATGAAGCCTCCAAATAGCAGG - Intergenic
1004583768 6:16979599-16979621 AGAAAGAGCATTCAAGTTGGAGG - Intergenic
1004640118 6:17506875-17506897 TGAAGGAGTCTTCAAAATGGGGG + Intronic
1007432348 6:41783994-41784016 AGGAGGACCCTCCCAAATGGAGG + Intronic
1007629892 6:43267429-43267451 AGAGGGCGCCTCCAAAAAGGTGG - Intronic
1011391111 6:86854726-86854748 AGATGGAGCCTTCAACTTGGGGG - Intergenic
1011403349 6:86989058-86989080 AGAAGTAGCCTCTAGTTTGGGGG - Intronic
1014623987 6:123703584-123703606 AGGAGCAGACTCCAAATTGCGGG + Intergenic
1015944367 6:138485046-138485068 AGAGAGAGCAGCCAAATTGGAGG + Intronic
1016100487 6:140093444-140093466 GGAAAGAGCCTGCAAAATGGAGG + Intergenic
1016987619 6:149906825-149906847 AGAAGGAGTCTCTAAGATGGAGG + Intergenic
1017993936 6:159514456-159514478 AGCAGGAGCCTCCTGATTTGAGG + Intergenic
1020424310 7:8046500-8046522 AGAAGAAGCCTCCAGATAGCAGG - Intronic
1021185664 7:17561645-17561667 AGTAGGAGCCTCTAAATATGGGG - Intergenic
1022778708 7:33555659-33555681 AGAAGGAACCCCCAGATTGCTGG + Intronic
1024984843 7:55186056-55186078 GGAAGGAGACTCCAAGCTGGTGG + Intronic
1025638282 7:63343517-63343539 AGAAGATACCTCTAAATTGGGGG + Intergenic
1025644414 7:63404572-63404594 AGAAGATACCTCTAAATTGGGGG - Intergenic
1027710479 7:81594903-81594925 AGAAGGAGCTGCTAAAGTGGTGG - Intergenic
1028350397 7:89839819-89839841 GGAAGATGCCTCCAAATTGCAGG + Intergenic
1028575531 7:92346090-92346112 AGCAGTTGCCTACAAATTGGGGG - Intronic
1029552935 7:101247601-101247623 AAAAGGAGCCTCCTAATAGAAGG - Intronic
1031572873 7:123381292-123381314 ATCAGGAGCCACCAAAGTGGAGG - Intergenic
1033420296 7:141199499-141199521 AGAAGCAGCCTCCCCACTGGGGG - Intronic
1033547525 7:142415073-142415095 ATAAGGAGCTTTCAAATTGGAGG + Intergenic
1041719309 8:60961831-60961853 GGTAGGAGCCTCCAAGATGGTGG + Intergenic
1041854947 8:62440988-62441010 AGATGAAGCCTTCAAAATGGAGG - Intronic
1049401401 8:142429119-142429141 GGAAGGAGCGTCCCAATGGGAGG - Intergenic
1051756551 9:20407167-20407189 GAAAGGAGTCTCCAAACTGGAGG + Intronic
1055277968 9:74641120-74641142 GGGAGGAGCCTCCAAGTTTGTGG + Intronic
1056897508 9:90564651-90564673 AGAAGGGGCCTGAGAATTGGAGG - Intergenic
1059709479 9:116854626-116854648 AGAAGGAAGCCCCAAATTGGAGG - Intronic
1060478264 9:124000750-124000772 AGAAGGTGGTTCCAAATTGTGGG - Intergenic
1203372042 Un_KI270442v1:316476-316498 AGAAGGAGCAGCCAAAGAGGTGG + Intergenic
1187842516 X:23503786-23503808 AGAAAGAGCTTACAAATTGGAGG + Intergenic
1195626794 X:107012179-107012201 AGAAGTAGCTTGCACATTGGTGG + Intergenic
1199584350 X:149398008-149398030 AGTAGGAGACTCCAATTTGTAGG - Intergenic