ID: 1114237017

View in Genome Browser
Species Human (GRCh38)
Location 14:20832713-20832735
Sequence ACCTTTCTGTCTACTCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114237017_1114237023 6 Left 1114237017 14:20832713-20832735 CCTTCTGGAGTAGACAGAAAGGT No data
Right 1114237023 14:20832742-20832764 ATAGGCTGTGCAGGGTTTAAAGG No data
1114237017_1114237021 -3 Left 1114237017 14:20832713-20832735 CCTTCTGGAGTAGACAGAAAGGT No data
Right 1114237021 14:20832733-20832755 GGTTGGGTAATAGGCTGTGCAGG 0: 13
1: 10
2: 5
3: 7
4: 117
1114237017_1114237025 16 Left 1114237017 14:20832713-20832735 CCTTCTGGAGTAGACAGAAAGGT No data
Right 1114237025 14:20832752-20832774 CAGGGTTTAAAGGCTCACGGAGG No data
1114237017_1114237028 19 Left 1114237017 14:20832713-20832735 CCTTCTGGAGTAGACAGAAAGGT No data
Right 1114237028 14:20832755-20832777 GGTTTAAAGGCTCACGGAGGGGG No data
1114237017_1114237022 -2 Left 1114237017 14:20832713-20832735 CCTTCTGGAGTAGACAGAAAGGT No data
Right 1114237022 14:20832734-20832756 GTTGGGTAATAGGCTGTGCAGGG No data
1114237017_1114237026 17 Left 1114237017 14:20832713-20832735 CCTTCTGGAGTAGACAGAAAGGT No data
Right 1114237026 14:20832753-20832775 AGGGTTTAAAGGCTCACGGAGGG No data
1114237017_1114237027 18 Left 1114237017 14:20832713-20832735 CCTTCTGGAGTAGACAGAAAGGT No data
Right 1114237027 14:20832754-20832776 GGGTTTAAAGGCTCACGGAGGGG No data
1114237017_1114237024 13 Left 1114237017 14:20832713-20832735 CCTTCTGGAGTAGACAGAAAGGT No data
Right 1114237024 14:20832749-20832771 GTGCAGGGTTTAAAGGCTCACGG No data
1114237017_1114237029 29 Left 1114237017 14:20832713-20832735 CCTTCTGGAGTAGACAGAAAGGT No data
Right 1114237029 14:20832765-20832787 CTCACGGAGGGGGCCTTTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114237017 Original CRISPR ACCTTTCTGTCTACTCCAGA AGG (reversed) Intergenic
No off target data available for this crispr