ID: 1114237029

View in Genome Browser
Species Human (GRCh38)
Location 14:20832765-20832787
Sequence CTCACGGAGGGGGCCTTTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114237017_1114237029 29 Left 1114237017 14:20832713-20832735 CCTTCTGGAGTAGACAGAAAGGT No data
Right 1114237029 14:20832765-20832787 CTCACGGAGGGGGCCTTTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114237029 Original CRISPR CTCACGGAGGGGGCCTTTAG CGG Intergenic
No off target data available for this crispr