ID: 1114244508

View in Genome Browser
Species Human (GRCh38)
Location 14:20900171-20900193
Sequence CTAGCTAACCCCCTGGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114244508_1114244519 26 Left 1114244508 14:20900171-20900193 CCCCTTTCCAGGGGGTTAGCTAG No data
Right 1114244519 14:20900220-20900242 AATCACTTGCTAGAGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114244508 Original CRISPR CTAGCTAACCCCCTGGAAAG GGG (reversed) Intergenic
No off target data available for this crispr