ID: 1114248766

View in Genome Browser
Species Human (GRCh38)
Location 14:20939146-20939168
Sequence TCTCTCCTCCAGACAGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114248766_1114248773 23 Left 1114248766 14:20939146-20939168 CCCAACACTGTCTGGAGGAGAGA No data
Right 1114248773 14:20939192-20939214 GCTTTCTGGTCATTGTGGCATGG No data
1114248766_1114248774 24 Left 1114248766 14:20939146-20939168 CCCAACACTGTCTGGAGGAGAGA No data
Right 1114248774 14:20939193-20939215 CTTTCTGGTCATTGTGGCATGGG No data
1114248766_1114248772 18 Left 1114248766 14:20939146-20939168 CCCAACACTGTCTGGAGGAGAGA No data
Right 1114248772 14:20939187-20939209 CTTTAGCTTTCTGGTCATTGTGG No data
1114248766_1114248770 9 Left 1114248766 14:20939146-20939168 CCCAACACTGTCTGGAGGAGAGA No data
Right 1114248770 14:20939178-20939200 TCTGACAGCCTTTAGCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114248766 Original CRISPR TCTCTCCTCCAGACAGTGTT GGG (reversed) Intergenic
No off target data available for this crispr