ID: 1114249765

View in Genome Browser
Species Human (GRCh38)
Location 14:20948670-20948692
Sequence CTGTAGTCTAATAGGTGATC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114249757_1114249765 -6 Left 1114249757 14:20948653-20948675 CCCTTCCCTTCACCTACCTGTAG No data
Right 1114249765 14:20948670-20948692 CTGTAGTCTAATAGGTGATCGGG No data
1114249758_1114249765 -7 Left 1114249758 14:20948654-20948676 CCTTCCCTTCACCTACCTGTAGT No data
Right 1114249765 14:20948670-20948692 CTGTAGTCTAATAGGTGATCGGG No data
1114249756_1114249765 11 Left 1114249756 14:20948636-20948658 CCTCTTCTTGGCTATCTCCCTTC No data
Right 1114249765 14:20948670-20948692 CTGTAGTCTAATAGGTGATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114249765 Original CRISPR CTGTAGTCTAATAGGTGATC GGG Intergenic
No off target data available for this crispr