ID: 1114250443

View in Genome Browser
Species Human (GRCh38)
Location 14:20955514-20955536
Sequence AGGAGCTACAGCGCGGAGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 69}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114250434_1114250443 15 Left 1114250434 14:20955476-20955498 CCCTGAACCCCAGAACAACCAGC 0: 3
1: 0
2: 0
3: 9
4: 197
Right 1114250443 14:20955514-20955536 AGGAGCTACAGCGCGGAGACTGG 0: 1
1: 0
2: 0
3: 10
4: 69
1114250439_1114250443 6 Left 1114250439 14:20955485-20955507 CCAGAACAACCAGCTGGATCAGT 0: 2
1: 1
2: 2
3: 5
4: 91
Right 1114250443 14:20955514-20955536 AGGAGCTACAGCGCGGAGACTGG 0: 1
1: 0
2: 0
3: 10
4: 69
1114250440_1114250443 -3 Left 1114250440 14:20955494-20955516 CCAGCTGGATCAGTTCTCACAGG 0: 2
1: 0
2: 1
3: 9
4: 134
Right 1114250443 14:20955514-20955536 AGGAGCTACAGCGCGGAGACTGG 0: 1
1: 0
2: 0
3: 10
4: 69
1114250435_1114250443 14 Left 1114250435 14:20955477-20955499 CCTGAACCCCAGAACAACCAGCT 0: 3
1: 0
2: 1
3: 22
4: 198
Right 1114250443 14:20955514-20955536 AGGAGCTACAGCGCGGAGACTGG 0: 1
1: 0
2: 0
3: 10
4: 69
1114250437_1114250443 8 Left 1114250437 14:20955483-20955505 CCCCAGAACAACCAGCTGGATCA 0: 3
1: 0
2: 0
3: 20
4: 179
Right 1114250443 14:20955514-20955536 AGGAGCTACAGCGCGGAGACTGG 0: 1
1: 0
2: 0
3: 10
4: 69
1114250438_1114250443 7 Left 1114250438 14:20955484-20955506 CCCAGAACAACCAGCTGGATCAG 0: 2
1: 1
2: 2
3: 8
4: 152
Right 1114250443 14:20955514-20955536 AGGAGCTACAGCGCGGAGACTGG 0: 1
1: 0
2: 0
3: 10
4: 69
1114250432_1114250443 23 Left 1114250432 14:20955468-20955490 CCAGCTGCCCCTGAACCCCAGAA 0: 3
1: 0
2: 0
3: 33
4: 379
Right 1114250443 14:20955514-20955536 AGGAGCTACAGCGCGGAGACTGG 0: 1
1: 0
2: 0
3: 10
4: 69
1114250433_1114250443 16 Left 1114250433 14:20955475-20955497 CCCCTGAACCCCAGAACAACCAG 0: 3
1: 0
2: 1
3: 19
4: 260
Right 1114250443 14:20955514-20955536 AGGAGCTACAGCGCGGAGACTGG 0: 1
1: 0
2: 0
3: 10
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114250443 Original CRISPR AGGAGCTACAGCGCGGAGAC TGG Exonic
900113522 1:1019551-1019573 GGGAGCTGCGGCGCGGAGGCGGG - Intergenic
902058338 1:13620791-13620813 AGGAGCTGCAGCATGGAGTCTGG + Intergenic
906681043 1:47725544-47725566 AGGGAGTACAGCGCCGAGACAGG - Intergenic
914414280 1:147464643-147464665 AGGAGCTTCTGGGCAGAGACTGG + Intergenic
915167801 1:153958287-153958309 AGCAGTTACGGAGCGGAGACCGG - Intronic
916868761 1:168888897-168888919 AATAGCTACAGCACTGAGACAGG + Intergenic
918818421 1:189222180-189222202 AGCAGCTACAGCAGGGAGAAAGG - Intergenic
920679356 1:208060632-208060654 GGGAGCTTCAGAGTGGAGACTGG - Intronic
921130863 1:212218472-212218494 AGGAGCTCCAGGGCAGAGACTGG + Intergenic
922603206 1:226872181-226872203 AGCAGCTACGGAGGGGAGACAGG - Intronic
923022315 1:230174646-230174668 CGGAGGGACAGAGCGGAGACAGG - Intronic
1063352721 10:5371639-5371661 AGGAGCTGCAGAGCAGAGACTGG + Intronic
1066272355 10:33836311-33836333 AGGAGCCTCAGCACAGAGACAGG + Intergenic
1067958918 10:50825640-50825662 AGGAGCTACAACACTGAGAGAGG - Intronic
1070652861 10:78250571-78250593 AGGAGATGCAGCGCAGGGACTGG - Intergenic
1074761099 10:116668133-116668155 AGAAGCTAGAGCGCCTAGACTGG + Intronic
1077169997 11:1161827-1161849 AGGAGGTACAGGGCAGAGGCAGG + Intronic
1080416306 11:32072809-32072831 AGGAGTTACAGAGGGCAGACTGG + Intronic
1081748663 11:45491197-45491219 AGGAGCTACAGAGGGCAGAAAGG + Intergenic
1082816709 11:57514361-57514383 GGAAGCTGCAGCGCGCAGACAGG - Intronic
1089249151 11:117144809-117144831 AGGAGCTGCAGCGCCCAGCCGGG - Intronic
1090390354 11:126383782-126383804 AGGGGCTACTGCGCAGAGCCTGG + Intronic
1090863511 11:130675001-130675023 GGGAGCTACAGAGGGGAGAAAGG + Intronic
1091888239 12:4031875-4031897 AGGAGCAGAAGCGCGGAGAGAGG - Intergenic
1093135029 12:15439706-15439728 AGGAGGTCCAGCTCGGTGACGGG - Intronic
1093539476 12:20264670-20264692 AGGGGCTACAGCCAGGAAACAGG - Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1103980915 12:124736483-124736505 AGGAGCTGCTGGGTGGAGACAGG - Intergenic
1112009197 13:95279850-95279872 AGGAACAACAGAGCTGAGACTGG + Intronic
1114243502 14:20891429-20891451 AGGAGCCACAGCTCAGAGACTGG + Exonic
1114250443 14:20955514-20955536 AGGAGCTACAGCGCGGAGACTGG + Exonic
1114544187 14:23486490-23486512 AGGAGCTCCAGCGGGGAGATGGG - Intronic
1119600271 14:75971251-75971273 AGGATCTACAGGGCAGAGAAAGG + Exonic
1123683731 15:22782709-22782731 AGGGGCCACAGCAAGGAGACTGG + Intronic
1128090931 15:64918432-64918454 AGCAGGTACAGGGAGGAGACAGG - Intronic
1128686745 15:69692115-69692137 AGGAGGGACAGTGCGGAGACGGG - Intergenic
1136382216 16:29900987-29901009 GGGAGCTTCAGCGTGGAGAGAGG + Exonic
1142050031 16:87951847-87951869 CGGAGCCACGGCGGGGAGACTGG + Intronic
1142764527 17:2057822-2057844 AAGAGCAGCAGCGAGGAGACCGG + Exonic
1144586853 17:16492258-16492280 CGGAGCTCCGGCGCGGAGGCGGG - Intergenic
1152002452 17:77655214-77655236 AGGAGCCACAGCGGGGAGGCGGG + Intergenic
1160921589 19:1523435-1523457 GGGAGCTTCAGCCCGGAGAAGGG - Intergenic
1168273644 19:55264742-55264764 AGGAGAGACAGCAAGGAGACAGG - Intronic
1168299142 19:55393365-55393387 AGGAGCTTCAGGGAGGAGAGAGG - Intronic
926112433 2:10191887-10191909 AGGACCTACAGCGTGGAGGCAGG + Intronic
927298671 2:21484841-21484863 AGGACCTACAGCCCGGAGTGTGG - Intergenic
931113590 2:59140257-59140279 AGGAGTTAGAGGGCAGAGACAGG - Intergenic
942166028 2:173241899-173241921 AGGAGCTACAGAAAGGGGACAGG + Intronic
944149779 2:196545281-196545303 AGGAGTTTCAGCCCTGAGACTGG - Intronic
948606602 2:239139718-239139740 GGGAGCGTCAGCGCGGAGAACGG - Exonic
948741319 2:240048397-240048419 AGGAGAGACAGTGCGGAGATGGG - Intergenic
1168856996 20:1015548-1015570 AGGAGATACAGGGCAGAAACGGG - Intergenic
1175549374 20:59806803-59806825 ATCAGCTACAGCGTGGAGCCAGG - Intronic
1177733972 21:25065125-25065147 AGGAGCTAGTGCTTGGAGACTGG - Intergenic
1177989965 21:28025633-28025655 AGGAGTTACAGGAAGGAGACAGG - Intergenic
950500199 3:13358859-13358881 AGGAGCTGCAGCCTGGAGGCAGG + Intronic
975694239 4:76995830-76995852 AGGAGCTACAGGGTGAAGAGGGG + Intronic
976297263 4:83484907-83484929 CGGAGCAACAGCGGGGAGGCAGG + Intronic
978202307 4:106036334-106036356 AGTAGCTACATCACAGAGACAGG + Intergenic
988715526 5:33823546-33823568 GGGAGCTACAGTGAGTAGACGGG + Intronic
988808382 5:34761600-34761622 AGAAGAAACAGCGGGGAGACAGG - Intronic
992710987 5:79455872-79455894 ATGAGCTACCGCGCTGGGACGGG - Intronic
998246905 5:140514993-140515015 ATGAGCTACTGCGCCCAGACAGG - Intronic
1007870242 6:45027275-45027297 AGGAGCTACCGTGCCCAGACTGG + Intronic
1028950632 7:96630931-96630953 AGGAGCTACAGCCTGGAAAGGGG + Intronic
1029639886 7:101814321-101814343 CGGAGCTACAGCGCGGCGGCCGG + Intergenic
1035485000 7:159216150-159216172 AAGAGCTACAGGGCAGAGTCGGG - Intergenic
1038899433 8:31825905-31825927 TTGAGCTACATTGCGGAGACAGG + Intronic
1038899740 8:31828986-31829008 TTGAGCTACAATGCGGAGACAGG + Intronic
1039755277 8:40516205-40516227 AGGAGGCACATCGGGGAGACAGG + Intergenic
1042146383 8:65734448-65734470 AGGAGCTACAGAGAGGAGGCAGG - Intronic
1045196748 8:99940313-99940335 AGGAGCCACAGCACGGGGGCAGG - Intergenic
1048199194 8:132357686-132357708 AGAAGCAACAGCTTGGAGACTGG - Intronic
1051149338 9:14063535-14063557 AGGGGCTACAGCTCAGGGACAGG - Intergenic
1053058272 9:35007329-35007351 AGCAGCCACTGCACGGAGACAGG - Intergenic
1053413846 9:37933852-37933874 AGGAGCTAGAGCTCGGAGCTGGG - Intronic
1062428451 9:136516686-136516708 AGGAGCTGCAGTGCCCAGACAGG - Intronic
1186498600 X:10032430-10032452 AGGAGCTGAAGCAAGGAGACTGG + Intronic
1187547123 X:20266093-20266115 AGGGGCTGCTGCGGGGAGACCGG - Intronic
1193391011 X:80929432-80929454 AGGGGCTGCAGCGCGGAGGCAGG - Intergenic