ID: 1114251585

View in Genome Browser
Species Human (GRCh38)
Location 14:20966411-20966433
Sequence CTAGGATATTAGCCTGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114251580_1114251585 -10 Left 1114251580 14:20966398-20966420 CCCTTCCCACTGCCTAGGATATT No data
Right 1114251585 14:20966411-20966433 CTAGGATATTAGCCTGATACTGG No data
1114251576_1114251585 2 Left 1114251576 14:20966386-20966408 CCAACCAACATCCCCTTCCCACT No data
Right 1114251585 14:20966411-20966433 CTAGGATATTAGCCTGATACTGG No data
1114251579_1114251585 -9 Left 1114251579 14:20966397-20966419 CCCCTTCCCACTGCCTAGGATAT No data
Right 1114251585 14:20966411-20966433 CTAGGATATTAGCCTGATACTGG No data
1114251577_1114251585 -2 Left 1114251577 14:20966390-20966412 CCAACATCCCCTTCCCACTGCCT No data
Right 1114251585 14:20966411-20966433 CTAGGATATTAGCCTGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114251585 Original CRISPR CTAGGATATTAGCCTGATAC TGG Intergenic
No off target data available for this crispr