ID: 1114265764

View in Genome Browser
Species Human (GRCh38)
Location 14:21071619-21071641
Sequence CCTGCCGCGGCCGTTTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 94}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114265755_1114265764 -10 Left 1114265755 14:21071606-21071628 CCCCTCCTCCCCTCCTGCCGCGG 0: 1
1: 0
2: 2
3: 72
4: 766
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265744_1114265764 15 Left 1114265744 14:21071581-21071603 CCCGCCCGCCGCCTCCCTCCCCA 0: 1
1: 0
2: 14
3: 221
4: 2219
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265743_1114265764 22 Left 1114265743 14:21071574-21071596 CCGTGCTCCCGCCCGCCGCCTCC 0: 1
1: 1
2: 7
3: 83
4: 945
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265748_1114265764 7 Left 1114265748 14:21071589-21071611 CCGCCTCCCTCCCCAGACCCCTC 0: 1
1: 2
2: 58
3: 1779
4: 11287
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265753_1114265764 -4 Left 1114265753 14:21071600-21071622 CCCAGACCCCTCCTCCCCTCCTG 0: 1
1: 0
2: 8
3: 102
4: 890
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265751_1114265764 0 Left 1114265751 14:21071596-21071618 CCTCCCCAGACCCCTCCTCCCCT 0: 1
1: 1
2: 10
3: 225
4: 2292
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265746_1114265764 11 Left 1114265746 14:21071585-21071607 CCCGCCGCCTCCCTCCCCAGACC 0: 1
1: 0
2: 6
3: 112
4: 1143
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265750_1114265764 1 Left 1114265750 14:21071595-21071617 CCCTCCCCAGACCCCTCCTCCCC 0: 1
1: 1
2: 25
3: 332
4: 2948
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265754_1114265764 -5 Left 1114265754 14:21071601-21071623 CCAGACCCCTCCTCCCCTCCTGC 0: 1
1: 1
2: 14
3: 185
4: 1602
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265747_1114265764 10 Left 1114265747 14:21071586-21071608 CCGCCGCCTCCCTCCCCAGACCC 0: 1
1: 0
2: 14
3: 235
4: 2155
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265745_1114265764 14 Left 1114265745 14:21071582-21071604 CCGCCCGCCGCCTCCCTCCCCAG 0: 1
1: 1
2: 10
3: 251
4: 2410
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265749_1114265764 4 Left 1114265749 14:21071592-21071614 CCTCCCTCCCCAGACCCCTCCTC 0: 1
1: 2
2: 42
3: 1309
4: 4323
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94
1114265752_1114265764 -3 Left 1114265752 14:21071599-21071621 CCCCAGACCCCTCCTCCCCTCCT 0: 1
1: 1
2: 13
3: 191
4: 1648
Right 1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114265764 Original CRISPR CCTGCCGCGGCCGTTTCCTG TGG Intronic
901303690 1:8217375-8217397 CCGGCCCCGGCCCCTTCCTGCGG - Intergenic
903124039 1:21235785-21235807 CCTGCCTCGGCCCTTTTCTAAGG + Intronic
906291454 1:44622232-44622254 CCTGCCGCGCCCGATGCCGGAGG + Intronic
916496488 1:165352770-165352792 TCTGACTCGGCCGTTTCCAGAGG - Intronic
916920951 1:169466450-169466472 CCTGCCGCTGCCCTCTTCTGGGG - Intronic
922221548 1:223612155-223612177 CCAGCAGCGTCTGTTTCCTGTGG - Intronic
923708298 1:236363761-236363783 TCTGCCACGGTTGTTTCCTGAGG + Intronic
1062874031 10:931319-931341 CCCGCCGCGGCCGCGTCCTCCGG + Intronic
1070685247 10:78475821-78475843 CCTGCCTTGGCAGTTTCCTTGGG + Intergenic
1074753598 10:116609192-116609214 CCTGCCGCGGCCGCCTCCCGGGG + Intergenic
1074756305 10:116627006-116627028 CCTGCCTGGGCCCTGTCCTGTGG + Intronic
1077233721 11:1469993-1470015 ACGGCCCCGGCCGTGTCCTGTGG - Exonic
1083811158 11:65107748-65107770 CCTGCAGTGGGCCTTTCCTGGGG + Intronic
1089303176 11:117510940-117510962 CCTGCTGTGCCCCTTTCCTGTGG + Intronic
1099973477 12:89524424-89524446 CCTGGCACGGCCGGCTCCTGCGG + Exonic
1104723124 12:131057382-131057404 GCTGCTGTGGCCGTTTCCTAGGG + Intronic
1104826302 12:131711653-131711675 CGTGCCGCGTCCGTCTCCGGAGG + Intronic
1105240882 13:18609206-18609228 CCGACCGCGGCCGGTGCCTGAGG + Intergenic
1107292320 13:38868938-38868960 GCTGCAGGGGCTGTTTCCTGGGG - Intronic
1108136822 13:47373137-47373159 CCTGCAGTGGCTGTTTCATGAGG + Intergenic
1108221098 13:48233608-48233630 CCCGGCGCTCCCGTTTCCTGTGG + Intronic
1111091694 13:83454086-83454108 CCGGCCGCAGGCGTTTCCAGCGG + Intergenic
1112938651 13:104832458-104832480 CCTGCCACTGCCATTTCCTCAGG + Intergenic
1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG + Intronic
1119225831 14:72943902-72943924 CCTGCTGTGGCGGTCTCCTGGGG - Intronic
1122868908 14:104625108-104625130 CCTGCCCCTGCCATTGCCTGAGG + Intergenic
1123490476 15:20775933-20775955 CCGACCGCGGCCGGTGCCTGAGG - Intergenic
1123546977 15:21345020-21345042 CCGACCGCGGCCGGTGCCTGAGG - Intergenic
1129600700 15:76996551-76996573 CCTCCCCGGGCCTTTTCCTGGGG + Intronic
1131067736 15:89444687-89444709 CCTGCCCAGGCCCCTTCCTGGGG + Intergenic
1202955308 15_KI270727v1_random:72236-72258 CCGACCGCGGCCGGTGCCTGAGG - Intergenic
1135328629 16:21543550-21543572 CCTGCCACGGTCATTCCCTGGGG - Intergenic
1136338979 16:29629523-29629545 CCTGCCACGGTCATTCCCTGGGG - Intergenic
1140221719 16:73048487-73048509 CCCGCCGGGGCCGGTTCCCGGGG - Intronic
1142970286 17:3606689-3606711 CCTGCTGCTTCCGTTGCCTGAGG - Intergenic
1145743258 17:27293980-27294002 CCCGGCGCGGGCGTTGCCTGGGG - Intergenic
1148119131 17:45197510-45197532 CCTGCCTGGGCCTTTTTCTGGGG - Intergenic
1148157003 17:45430281-45430303 GCAGCCGCGGCGTTTTCCTGCGG + Intronic
1152071211 17:78134677-78134699 CCTGCCTTGGCCGTGACCTGTGG - Intronic
1152613736 17:81328647-81328669 CCTGCAGCAGCCCTTTCCTGAGG + Intronic
1153713478 18:7822876-7822898 CCTGCCGCAGCTGTGTGCTGTGG + Intronic
1154448088 18:14450702-14450724 CCGACCGCGGCCGGTGCCTGAGG - Intergenic
1155461522 18:26090091-26090113 CGTGCCGCGGCTGCTTCGTGCGG - Intronic
1160761889 19:789616-789638 CTGGCTGCGGCTGTTTCCTGCGG + Intergenic
1160912663 19:1482032-1482054 CCTGCCGCGGCGGCTCCCCGAGG - Exonic
1162034658 19:7932506-7932528 GCTGCCGAGGCTGTTTTCTGAGG - Intronic
1162199835 19:9011923-9011945 CCTGCCCAGGGTGTTTCCTGGGG - Intergenic
1162450016 19:10748935-10748957 CCTGCCGAAGCCTCTTCCTGTGG + Intronic
1164694924 19:30236229-30236251 CCTGCCGCCGCCGGGTACTGAGG + Intronic
1165753641 19:38278121-38278143 CCAGCCCTGGCCGTTTCCTTTGG + Intronic
1165993075 19:39826954-39826976 CCTGCAGCCGCCGTGTCCCGGGG + Exonic
927982154 2:27380813-27380835 CCCGCCGCGGCCGCTTCCCACGG - Intergenic
1171413704 20:24963424-24963446 GCTGCTGCGGCCCTGTCCTGCGG - Exonic
1176547711 21:8208755-8208777 CCTGCCGCGGCCCTTCCCCGAGG + Intergenic
1176555608 21:8252961-8252983 CCTGCCGCGGCCCTTCCCCGAGG + Intergenic
1176574538 21:8435989-8436011 CCTGCCGCGGCCCTTCCCCGAGG + Intergenic
1176611150 21:8987281-8987303 CCTGCCGCGGCCCTTCCCCGAGG + Intergenic
1179541889 21:42088389-42088411 CCTGCCACGGCCACTGCCTGTGG + Exonic
1180154975 21:45973274-45973296 CCTGCCGCGTCCGTGTCCCGGGG + Intergenic
1181001106 22:19988123-19988145 CCTGCGGAGGCTGTTTTCTGAGG - Intronic
1181639929 22:24190981-24191003 CCTGCCAGGGGCTTTTCCTGGGG + Intergenic
1184602736 22:45553076-45553098 CCTGCCTTGGCCAGTTCCTGGGG + Intronic
1203252585 22_KI270733v1_random:125040-125062 CCTGCCGCGGCCCTTCCCCGAGG + Intergenic
1203260641 22_KI270733v1_random:170126-170148 CCTGCCGCGGCCCTTCCCCGAGG + Intergenic
950060212 3:10064804-10064826 CCTGCCGCTGCTGTTTTCTCAGG + Exonic
950301579 3:11884027-11884049 CCTGCCGCTGCTGTTTTCTCAGG + Intergenic
955015249 3:55063800-55063822 CCTGCCACGGCCCATTCTTGAGG - Intronic
961081537 3:124032952-124032974 CCTGGCCCGGGCTTTTCCTGCGG + Intergenic
966520718 3:180870551-180870573 CCTGCCACGCCCCTATCCTGTGG - Intronic
968377453 4:54820-54842 CCTGCCTCGGCCTGTACCTGTGG + Intronic
968519325 4:1028563-1028585 CCTGCCGGGGCCCTGCCCTGTGG + Intergenic
968567807 4:1323690-1323712 TCTGCCAGGGCTGTTTCCTGTGG + Intronic
986578375 5:9236234-9236256 CCTGCCGTGGGCCTTGCCTGGGG - Intronic
997386247 5:133475080-133475102 CCTGCCCGGGCCATGTCCTGGGG - Intronic
998152310 5:139764482-139764504 CCTGGCGCGCCCGCTCCCTGGGG + Intergenic
1004354411 6:14918783-14918805 CCTGCCCCGCCTCTTTCCTGGGG - Intergenic
1013605941 6:111748286-111748308 CCAGCTGCAGCCGTTTCCTGTGG - Intronic
1015843685 6:137497047-137497069 CCTGCCGCAGCCGGTTCCGAGGG + Intergenic
1016806522 6:148217622-148217644 ACTGCCCTGGCTGTTTCCTGAGG - Intergenic
1017448074 6:154527256-154527278 CCTGCCTCTGAGGTTTCCTGGGG - Intergenic
1018020955 6:159761993-159762015 CCTGCCGCGGGCGGGACCTGAGG - Exonic
1019460927 7:1158881-1158903 CCTCCCGGGGCCTTTTCCTGGGG + Intronic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1022871928 7:34488972-34488994 CCTGCCGCTGGCATTTCCTTAGG - Intergenic
1024452556 7:49564180-49564202 CCTGCCACAGCCTTTGCCTGAGG + Intergenic
1026004701 7:66591778-66591800 CCTGCCGCGGCCGGGGTCTGTGG + Intergenic
1026017542 7:66682690-66682712 CCTGCCGCGGCCGGGGGCTGTGG - Intronic
1026025588 7:66741244-66741266 CCTGCCGCGGCCGGGGGCTGTGG - Intronic
1029608510 7:101614297-101614319 CCTGCCGCAGCCGGTGCCAGAGG - Intronic
1029750105 7:102538415-102538437 CCTGCCGAGGGGGCTTCCTGAGG - Intronic
1029768056 7:102637523-102637545 CCTGCCGAGGGGGCTTCCTGAGG - Exonic
1031982342 7:128135959-128135981 CCTACCGCTGCGGTTTGCTGGGG - Intergenic
1032013336 7:128360666-128360688 CCCGCCCCTCCCGTTTCCTGGGG + Intronic
1035234011 7:157484578-157484600 CCTCCCGCGGCAGCTCCCTGGGG + Intergenic
1038633832 8:29269763-29269785 CCTGCGGCGGCTGGTTGCTGGGG - Intergenic
1040596799 8:48846463-48846485 TATGCCGCAGCTGTTTCCTGAGG - Intergenic
1047409478 8:124612353-124612375 CCTGCCTATGCCGTTTCCTGTGG - Intronic
1047462185 8:125077246-125077268 CCAGCCCCAGCCGCTTCCTGTGG - Intronic
1053013210 9:34647147-34647169 CCTGCCAGGGCCGCTTCATGCGG - Exonic
1053416303 9:37948899-37948921 CCTGCTGCTGCCGGGTCCTGGGG + Intronic
1057802665 9:98199527-98199549 GCTGCCGCAGCTGTTTCATGCGG + Exonic
1058045465 9:100352771-100352793 CCGGCCGCGGCCGGGTCCTCAGG - Exonic
1061416094 9:130447640-130447662 CCTGCCGTGGCCCTTTCTGGGGG + Intronic
1203468989 Un_GL000220v1:108191-108213 CCTGCCGCGGCCCTTCCCCGAGG + Intergenic
1203476810 Un_GL000220v1:152163-152185 CCTGCCGCGGCCCTTCCCCGAGG + Intergenic
1203571782 Un_KI270744v1:139426-139448 CCTGCCTCGGCCTGTACCTGTGG - Intergenic
1185461198 X:333467-333489 GCTGCCACCTCCGTTTCCTGGGG + Intergenic
1190114736 X:47619322-47619344 ACTGCCGCGGACGTCTCCCGTGG - Intronic
1190287180 X:48969489-48969511 CCAGCCGTTGCCGCTTCCTGCGG - Exonic
1192407483 X:70901101-70901123 CCTCCCGCCTCAGTTTCCTGAGG - Intronic
1200243252 X:154508547-154508569 CCTGCCCCAGCCGTGTCCTGAGG - Exonic