ID: 1114267480

View in Genome Browser
Species Human (GRCh38)
Location 14:21081499-21081521
Sequence GACTTCGTAGGCACATGAAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114267469_1114267480 4 Left 1114267469 14:21081472-21081494 CCTTTCTCTCCCATCCCCAACCC 0: 1
1: 1
2: 18
3: 265
4: 2259
Right 1114267480 14:21081499-21081521 GACTTCGTAGGCACATGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1114267468_1114267480 5 Left 1114267468 14:21081471-21081493 CCCTTTCTCTCCCATCCCCAACC 0: 1
1: 0
2: 13
3: 133
4: 1314
Right 1114267480 14:21081499-21081521 GACTTCGTAGGCACATGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1114267467_1114267480 10 Left 1114267467 14:21081466-21081488 CCTTACCCTTTCTCTCCCATCCC 0: 1
1: 2
2: 8
3: 190
4: 1736
Right 1114267480 14:21081499-21081521 GACTTCGTAGGCACATGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1114267466_1114267480 11 Left 1114267466 14:21081465-21081487 CCCTTACCCTTTCTCTCCCATCC 0: 1
1: 0
2: 9
3: 99
4: 994
Right 1114267480 14:21081499-21081521 GACTTCGTAGGCACATGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1114267471_1114267480 -6 Left 1114267471 14:21081482-21081504 CCATCCCCAACCCCTTTGACTTC 0: 1
1: 0
2: 5
3: 47
4: 552
Right 1114267480 14:21081499-21081521 GACTTCGTAGGCACATGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1114267472_1114267480 -10 Left 1114267472 14:21081486-21081508 CCCCAACCCCTTTGACTTCGTAG 0: 1
1: 0
2: 0
3: 15
4: 271
Right 1114267480 14:21081499-21081521 GACTTCGTAGGCACATGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1114267465_1114267480 30 Left 1114267465 14:21081446-21081468 CCTTCGTGAGCAACACAGGCCCT 0: 1
1: 0
2: 0
3: 16
4: 189
Right 1114267480 14:21081499-21081521 GACTTCGTAGGCACATGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1114267470_1114267480 -5 Left 1114267470 14:21081481-21081503 CCCATCCCCAACCCCTTTGACTT 0: 1
1: 0
2: 0
3: 29
4: 348
Right 1114267480 14:21081499-21081521 GACTTCGTAGGCACATGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114267480 Original CRISPR GACTTCGTAGGCACATGAAT GGG Exonic
902654930 1:17860552-17860574 GAATTGGTAGGTAGATGAATAGG - Intergenic
907070360 1:51529023-51529045 GACTTCTTATGTTCATGAATTGG + Intergenic
907231364 1:53002231-53002253 GACTTCATAGGCTCTTAAATAGG - Intronic
912108464 1:106311009-106311031 GACCTCATATGCACATGGATTGG + Intergenic
924832789 1:247615151-247615173 GGCTTCCTTGGCACAGGAATGGG + Intergenic
1066458521 10:35593400-35593422 GACTTCGGAGTCAAATCAATTGG + Intergenic
1068684434 10:59855197-59855219 GACTTAGTAGCTAGATGAATTGG - Intronic
1069020922 10:63487575-63487597 GATTTCCTAGGCACATCAATGGG + Intergenic
1082755612 11:57073319-57073341 GACTTCTGTGGCACATGGATAGG - Intergenic
1087381045 11:97405466-97405488 GTCTTTGTAGGCATATGACTGGG + Intergenic
1089787516 11:120918622-120918644 GACTTAGTGGGCACATGCCTTGG - Intronic
1090125819 11:124082824-124082846 AACTTCGTTGGCACAGGATTAGG + Intergenic
1090755363 11:129785497-129785519 GACATAGGAGGCAGATGAATTGG + Intergenic
1102056118 12:109897857-109897879 AACTTCATAAACACATGAATTGG - Intergenic
1103815828 12:123655086-123655108 GACTACGTAGGCTTATGAATGGG + Intronic
1108342123 13:49507525-49507547 GAATTGTTAGGCACAGGAATGGG + Intronic
1108945230 13:56014733-56014755 GTCTTCATAGGTACAGGAATAGG - Intergenic
1110280234 13:73684560-73684582 GACTTTGTAAGCAAATGAATTGG - Intergenic
1111959027 13:94789407-94789429 CACTTCTTAGCCACATGACTTGG + Intergenic
1114267480 14:21081499-21081521 GACTTCGTAGGCACATGAATGGG + Exonic
1116174358 14:41448215-41448237 GATTTTGTAGGCACATGGAAGGG - Intergenic
1121067331 14:90980722-90980744 GACCTCATAGGCAAATAAATAGG + Intronic
1127731199 15:61803535-61803557 CATGTTGTAGGCACATGAATGGG + Intergenic
1134089509 16:11384092-11384114 GACTTCGTAGGCCCAGGGTTTGG - Intronic
1135330131 16:21553966-21553988 TTCTACGTAGGCACATAAATAGG + Intergenic
1142043169 16:87908480-87908502 TTCTACGTAGGCACATAAATAGG + Intronic
1147884201 17:43673779-43673801 GACTTTGAAGGCCCATGAACTGG - Intergenic
1153928681 18:9859003-9859025 AACTTCCTAAGCCCATGAATTGG + Intronic
928291433 2:30040962-30040984 GCCTTGGTAGGCACTTAAATTGG - Intergenic
929036290 2:37695138-37695160 TACTTCAAAAGCACATGAATTGG + Intronic
935952121 2:108339535-108339557 AACTTCGTAGGCATGTGAACTGG + Intergenic
937140972 2:119599899-119599921 CACTTAATAAGCACATGAATGGG + Intronic
939285085 2:140119021-140119043 GTCTTCATATTCACATGAATTGG + Intergenic
940012403 2:149068813-149068835 GACTTCTCAGGCACATGATGTGG - Intronic
951480365 3:23154901-23154923 GACATCATATGCTCATGAATTGG + Intergenic
953117282 3:40005568-40005590 GATTTCATAGGCAGATGATTTGG + Intronic
956124062 3:65994802-65994824 GACTCTCTAGGCACATGAAGTGG + Intronic
962589761 3:136877778-136877800 TACTTCTTAGGCTCAGGAATTGG + Intronic
963830081 3:149997890-149997912 GACATCATATGCTCATGAATTGG + Intronic
966777841 3:183558610-183558632 GACTTCCTAGCCTGATGAATGGG + Intergenic
966777849 3:183558710-183558732 GACTTCCTAGCCTGATGAATGGG + Intergenic
974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG + Intergenic
974870257 4:67634248-67634270 GACTTCTTCTGCAGATGAATAGG + Exonic
975634143 4:76429559-76429581 GACTTCATGGACAAATGAATAGG - Intergenic
993401899 5:87463814-87463836 GACTTCTCAGGCTCATGGATTGG - Intergenic
994571582 5:101522083-101522105 GAATTTGGAGGCACATGAAATGG + Intergenic
999516220 5:152304192-152304214 GACTTCATAGATAGATGAATGGG + Intergenic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1024711289 7:52018085-52018107 GACATCACAGGCACATGAAGAGG - Intergenic
1041537010 8:58937844-58937866 GCCTTCTTTGGCTCATGAATTGG + Intronic
1043420826 8:80096840-80096862 GCCATCGTAGGGACATTAATTGG - Intronic
1044569539 8:93701024-93701046 GACTGTGTAGGCACAGGAAAAGG - Intronic
1052465521 9:28824347-28824369 CAATTAGTAGGCACATGATTAGG + Intergenic
1057717448 9:97505738-97505760 GACTTGGTGGGCAAATGAATGGG - Intronic
1058199577 9:102022509-102022531 TACTTTGTAGGAACATGGATGGG - Intergenic
1058349736 9:104008064-104008086 GACTGCAGAGGCACATGAATTGG - Intergenic
1188938729 X:36210903-36210925 GACTTGGTAGCCACATGCAAAGG - Intergenic
1189540522 X:41983049-41983071 GACATGGTAGGTACATGAAGAGG + Intergenic
1197788714 X:130228219-130228241 AACTTCCTTGGCACATGCATTGG - Intronic