ID: 1114271199

View in Genome Browser
Species Human (GRCh38)
Location 14:21101338-21101360
Sequence GGAGCCATGGAAGATAGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114271193_1114271199 7 Left 1114271193 14:21101308-21101330 CCTAGGAAGCACCTAATTCTTGT 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1114271199 14:21101338-21101360 GGAGCCATGGAAGATAGAGCTGG 0: 1
1: 0
2: 2
3: 37
4: 249
1114271192_1114271199 11 Left 1114271192 14:21101304-21101326 CCAGCCTAGGAAGCACCTAATTC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1114271199 14:21101338-21101360 GGAGCCATGGAAGATAGAGCTGG 0: 1
1: 0
2: 2
3: 37
4: 249
1114271189_1114271199 28 Left 1114271189 14:21101287-21101309 CCTATAACGCATTTTTCCCAGCC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1114271199 14:21101338-21101360 GGAGCCATGGAAGATAGAGCTGG 0: 1
1: 0
2: 2
3: 37
4: 249
1114271197_1114271199 -4 Left 1114271197 14:21101319-21101341 CCTAATTCTTGTGGGCAAAGGAG 0: 1
1: 0
2: 1
3: 15
4: 178
Right 1114271199 14:21101338-21101360 GGAGCCATGGAAGATAGAGCTGG 0: 1
1: 0
2: 2
3: 37
4: 249
1114271191_1114271199 12 Left 1114271191 14:21101303-21101325 CCCAGCCTAGGAAGCACCTAATT 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1114271199 14:21101338-21101360 GGAGCCATGGAAGATAGAGCTGG 0: 1
1: 0
2: 2
3: 37
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114271199 Original CRISPR GGAGCCATGGAAGATAGAGC TGG Exonic