ID: 1114271344

View in Genome Browser
Species Human (GRCh38)
Location 14:21102171-21102193
Sequence CTTCCTAGGCTGAGGGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114271344_1114271349 25 Left 1114271344 14:21102171-21102193 CCTACAACCCTCAGCCTAGGAAG 0: 1
1: 0
2: 2
3: 12
4: 167
Right 1114271349 14:21102219-21102241 TCTCAGCTGTCACCACTGACTGG 0: 1
1: 0
2: 0
3: 23
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114271344 Original CRISPR CTTCCTAGGCTGAGGGTTGT AGG (reversed) Intronic
900604787 1:3519135-3519157 CTTGCTGGGGTGTGGGTTGTGGG - Intronic
900960271 1:5914764-5914786 CTTCCTAGGCTGAAGGGAGCAGG + Intronic
901863149 1:12087569-12087591 CTTGCTAGCCTGATGGTTGGTGG + Intronic
902101713 1:13996120-13996142 CTCCCTTGGCTGGGGGTTGAGGG - Intergenic
902289614 1:15427646-15427668 CCTCCTAGGCTGGGGCTGGTGGG - Intronic
902792297 1:18777644-18777666 CTTCCTTGGCTGAGGTGTGATGG + Intergenic
904940197 1:34160367-34160389 TTTCCTTGGCTCAGGGTTGGAGG + Intronic
906666844 1:47628095-47628117 CTCCCGAGGCTGAGGGTACTGGG - Intergenic
906681880 1:47732390-47732412 CTGGCTAGGATGAGGGATGTGGG - Intergenic
907014947 1:51003591-51003613 CTTGCTAAGCTGAGAGTTTTGGG + Intergenic
907440577 1:54475825-54475847 CTTACTAGGGTGAGGGTGGGTGG - Intergenic
907475107 1:54700276-54700298 CTTCCCAGGCTGAGGGGGGCAGG - Intronic
907803440 1:57794508-57794530 GTGCCAAGGCTGAGGCTTGTAGG - Intronic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
911388209 1:97204523-97204545 AGTTCTAGGCTGAGGGTTTTAGG + Intronic
911946679 1:104118707-104118729 CTTCCTAAGATGAGGATTATGGG + Intergenic
916791349 1:168128023-168128045 ATGCTCAGGCTGAGGGTTGTGGG + Intronic
919659424 1:200229374-200229396 CTCCCCAGGCTGAGGTTTCTTGG + Intergenic
919946247 1:202320899-202320921 CTGCCTAGGCTGAGGTAGGTAGG + Intergenic
920964247 1:210689122-210689144 CTTCCCAGGCTCAGGGCTGTTGG - Intronic
1066757990 10:38730041-38730063 CGTCCTAGGCTCCGCGTTGTGGG + Intergenic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1068871761 10:61952810-61952832 CCTGCTAGCCTGAGGATTGTAGG + Intronic
1071834321 10:89404648-89404670 CTTCCCAGGCTGCAGGTTGCAGG + Intronic
1073004414 10:100311712-100311734 CTTCCCAGGGAGAGTGTTGTTGG - Intronic
1074159528 10:110826037-110826059 CGTCCTAGCCAGGGGGTTGTAGG + Intronic
1074319376 10:112387503-112387525 TTTCCTAGGTTGAGGGTGGCAGG + Intronic
1076602381 10:131667202-131667224 CTCGCCAGGCTGAGGCTTGTGGG + Intergenic
1077134982 11:994009-994031 CTGGCTTGGCTGAGGGTTGGAGG + Intronic
1078336362 11:10466345-10466367 CTTCGTAGGGGGAGGGTCGTTGG + Intronic
1080230483 11:30014348-30014370 GTTCCTAGTCTGTGGGTGGTAGG - Intronic
1081849434 11:46265022-46265044 CTTCCTGGGCTGGGGGCAGTGGG + Intergenic
1083769220 11:64857002-64857024 CGTCCTGAGCTGAGGGGTGTGGG - Intronic
1084043190 11:66554531-66554553 CTTCCTTGGCTGAGGTTTCTGGG - Exonic
1084770200 11:71337763-71337785 CTTCATAGGCTGAGTACTGTGGG + Intergenic
1084793913 11:71491642-71491664 CATCCTGGGCTGAGGAGTGTGGG - Intronic
1084937856 11:72596562-72596584 CTGCCTAGGCGGTGGGATGTAGG - Intronic
1086515128 11:87603018-87603040 CTTCCTGGGATGAAGCTTGTAGG + Intergenic
1087145361 11:94805421-94805443 ATTCCTAGGGTGAGGGTTGTGGG + Intronic
1089632391 11:119791863-119791885 CTTCCTGGGCTGTGGCATGTGGG - Intergenic
1094141665 12:27188157-27188179 CTTCTGAGGCTGAGGGTGGGGGG - Intergenic
1096516710 12:52160146-52160168 CTTCCTACACTGAGGGATTTGGG + Intergenic
1096648760 12:53051841-53051863 TTTCCTAGGCTGAAGGTGGAGGG - Exonic
1097051600 12:56226460-56226482 CTTTCTAGGCTGAGGAGAGTGGG - Intronic
1097278064 12:57826610-57826632 CTACCTGGGCTGAGAGTTTTGGG + Intronic
1097350789 12:58546529-58546551 CTTGCTAGGTTCAGGGTTTTAGG + Intronic
1098448888 12:70596761-70596783 CTTCCTAGGTTGTAGATTGTTGG + Intronic
1104270125 12:127275984-127276006 ATTCCTAGTCTGAGGGTTTTGGG + Intergenic
1109095276 13:58106499-58106521 ATGCCTATGCTGAAGGTTGTTGG - Intergenic
1112413014 13:99179926-99179948 CTTCCTAGAATGAGGGGTCTGGG - Intergenic
1112541127 13:100314133-100314155 ATTCCAAGAATGAGGGTTGTAGG + Intronic
1113927793 13:113951064-113951086 CTCTCTAGGCTGAGGCCTGTGGG + Intergenic
1114271344 14:21102171-21102193 CTTCCTAGGCTGAGGGTTGTAGG - Intronic
1114338423 14:21716709-21716731 CTTCCTAGGATTAGTGTTATGGG + Intergenic
1117965107 14:61198972-61198994 CTTGCAAGGCTGAGGGATGGGGG + Intronic
1118069117 14:62225834-62225856 CTTCCTTGGCTGCAGATTGTTGG + Intergenic
1118310966 14:64692755-64692777 CTTTCTAGGCTGGAGGCTGTGGG + Intergenic
1118763754 14:68896360-68896382 CTTCTCAGGCTGAGGCTGGTGGG - Intronic
1118808410 14:69257126-69257148 CATCCTTAGCTCAGGGTTGTAGG + Intergenic
1121757971 14:96419100-96419122 CTGCACAGGCTGTGGGTTGTGGG + Intronic
1122211483 14:100176888-100176910 TTTCCAAGGCTGAGGGGTGGTGG - Intergenic
1122316389 14:100828122-100828144 CTTCCTAGCCTGAGACCTGTTGG + Intergenic
1124254708 15:28131253-28131275 CTTCCAAGGCTGAGGATGCTGGG - Intronic
1125687879 15:41574242-41574264 CTTCCTAGGCTGAGCTCTCTTGG + Intronic
1128892088 15:71340548-71340570 CTTCCTAGGCTGTCTTTTGTAGG + Intronic
1131940719 15:97562040-97562062 CTTCCCAGGAAGTGGGTTGTCGG - Intergenic
1133774390 16:8885905-8885927 CATCCTAGGGAGAAGGTTGTGGG - Intergenic
1139473921 16:67192995-67193017 CTCCCTGGGCTCAGGGGTGTGGG + Exonic
1139772821 16:69292919-69292941 ATTCCTAAGTTGGGGGTTGTGGG - Intronic
1140456379 16:75107921-75107943 CCTCCTGGGCTGAGGGGTGAGGG - Exonic
1142035383 16:87859315-87859337 CTTCAGAGCCTGAGGGTTCTTGG - Intronic
1143728136 17:8864255-8864277 TTTCCTAGGCTCAGGGTTCCTGG + Intronic
1143898744 17:10157204-10157226 TTTCCTAGGCTGAGGACTCTGGG - Intronic
1145202883 17:20962829-20962851 CTTCCCAGGCTGAAGCTTTTTGG + Intergenic
1146293880 17:31633202-31633224 ATGCCTACGCTGAAGGTTGTGGG + Intergenic
1148382380 17:47209430-47209452 CTTCTTAGGCTCAGGCTTCTTGG - Exonic
1148580910 17:48743216-48743238 CTTCCTAGCTTGAGGGATGTGGG - Intergenic
1150289123 17:63971627-63971649 CTGCCTGGGCTGAGGGCTGCAGG - Intronic
1150294875 17:64002272-64002294 CTTCCTGGGATGAGGGGTGGGGG - Exonic
1152317036 17:79587183-79587205 CTTCCTATTCTCAGGGTTGCGGG - Intergenic
1157502783 18:48202852-48202874 CTTCCTCTGCCCAGGGTTGTGGG - Intronic
1158559221 18:58499560-58499582 CTCCTTAGGGTGAGGGTTATGGG + Intronic
1160691502 19:462339-462361 GGCCCTAGGCTGAGGGCTGTGGG + Intergenic
1162739444 19:12765780-12765802 CTTCCCAGGGTGAGGGTAGGGGG + Intronic
1163089967 19:15012760-15012782 ATGCCTGGGCTGAGGGCTGTGGG - Intronic
1163628659 19:18405158-18405180 CTGCCTAGACTGAGGGTTCTTGG - Intergenic
1164418932 19:28070391-28070413 CTTCCTAGGCTTGGGTTTCTAGG + Intergenic
1165261652 19:34624136-34624158 CTTTCTAGGCAGAGAGGTGTGGG + Intronic
1165402994 19:35613650-35613672 ATTCCTAGGGTGATGGTGGTAGG - Intronic
1165716066 19:38046579-38046601 CTTCATAGGCTGAGAGTTTTGGG + Intronic
925568687 2:5285658-5285680 CTGCCTAGGATGAGGTTTCTGGG - Intergenic
925860628 2:8172249-8172271 TTTTCTAGGCTGAGGCCTGTCGG - Intergenic
926882186 2:17558019-17558041 TTTCCTAGGATGAGGATTGGAGG + Intronic
927930522 2:27040615-27040637 CACCCTGGGATGAGGGTTGTGGG + Intronic
930689646 2:54347696-54347718 CATCCTAGGCAGAGGTTTGGAGG - Intronic
934113950 2:88766256-88766278 CCTTCCAGGCTGAGGGCTGTGGG + Intergenic
934636079 2:95991430-95991452 CTTTCCAGGCTGAGGGCTGCGGG - Intronic
934665950 2:96170878-96170900 TTTCCTTGGCTGTTGGTTGTTGG - Intergenic
934797567 2:97113996-97114018 CTTTCCAGGCTGAGGGCTGCGGG + Intronic
936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG + Intergenic
937413965 2:121699684-121699706 CTTGCAAGGCTGAGGGAGGTGGG - Intergenic
937855532 2:126669958-126669980 CTTCCTCGGCCCAGGGCTGTGGG + Intronic
938943620 2:136191039-136191061 CTTGCTAAGCTGAAGGCTGTTGG + Intergenic
940410652 2:153360198-153360220 CTCCCTTGGCTGGGGGTTGGGGG - Intergenic
940906941 2:159178302-159178324 CTTGCTAGGCTCAGGGTCCTTGG + Intronic
945210108 2:207374375-207374397 CTTCCATGGTTGGGGGTTGTGGG - Intergenic
947296780 2:228640066-228640088 CTTCCTAGTCTCAGGGATGCGGG - Intergenic
947430485 2:230023667-230023689 CTTCCTTGGTTGGGGGTAGTAGG + Intergenic
947589952 2:231379855-231379877 TTTCCTAGGATGGGGGTTATTGG - Intergenic
948338731 2:237232041-237232063 CTCCCTTGCCAGAGGGTTGTGGG + Intergenic
1170496520 20:16930566-16930588 CTCCCTTGGCTGGGGGATGTGGG - Intergenic
1174841903 20:53908963-53908985 CTTGGTTGGCTGAGGATTGTTGG + Intergenic
1175321972 20:58094604-58094626 GCTCCTAGGCTGAGGGTAGTGGG - Intergenic
1175721886 20:61292636-61292658 CTTCCAAGGCTCAGTGCTGTTGG - Intronic
1177084787 21:16689992-16690014 CTTCTTAGGCTCAGGCTTCTAGG - Intergenic
1180039887 21:45270471-45270493 CTTCCTTGGAGCAGGGTTGTTGG - Intronic
1184341046 22:43886101-43886123 ATGCCTAGGCCCAGGGTTGTGGG + Intronic
949615408 3:5748376-5748398 CTTCCTGGGGTGAGGGCTGAGGG + Intergenic
954329319 3:49881116-49881138 TTCCCCAGGCTGAGGGCTGTGGG + Intergenic
955031941 3:55230549-55230571 CTTCCTAGACTGAGCCTTCTTGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961795720 3:129407521-129407543 CTTCCTAGGCAGAGGTTCCTAGG + Intronic
963222542 3:142827434-142827456 CTTCTTGGTCTCAGGGTTGTGGG + Intronic
964831125 3:160885631-160885653 CTCCCTTGGCTGTGGGTTGGGGG - Intronic
965956574 3:174377646-174377668 CTTCTGAGTCTCAGGGTTGTGGG - Intergenic
980521950 4:133947189-133947211 CTTCATAGGCTGAGTACTGTGGG + Intergenic
980992290 4:139748270-139748292 CTCCCTAGGCTGGGGTTTCTAGG + Intronic
985441541 4:189984970-189984992 AATCCTAGGCTGAGGGAGGTGGG - Intergenic
985640742 5:1062483-1062505 TTTCCTAGGCCGAGGGCTGCAGG - Intronic
985969376 5:3362861-3362883 CTTCCTAGCATGAAGGTTCTTGG + Intergenic
986239872 5:5951406-5951428 CACACTGGGCTGAGGGTTGTTGG + Intergenic
986425509 5:7627224-7627246 CATCCTAGGTTGATTGTTGTGGG + Intronic
989348308 5:40454130-40454152 CTCCCTTGGCTGGGGGTTGGAGG + Intergenic
990570656 5:57075172-57075194 CTTCCAAGGCTGTGGCTTGGTGG + Intergenic
991611237 5:68451372-68451394 CTTCCTAGGAGGAGGGTTAGTGG + Intergenic
992712100 5:79469402-79469424 CTTCCAAGTCTGAGGGATGTTGG - Intronic
993650364 5:90513135-90513157 CTTTGTAGGCTGAGGTTTTTAGG - Exonic
995362112 5:111309263-111309285 CTGCCTGGGCTGAGAGATGTAGG + Intronic
995512340 5:112921867-112921889 CTGCCCAGGCTGAGGGTCGCGGG - Intronic
995960236 5:117830107-117830129 CTCCCTTGGCTGGGGGATGTGGG + Intergenic
998578086 5:143339707-143339729 CCTTCTAGGCTGAGGGTTGGTGG + Intronic
1001788739 5:174436719-174436741 CTTCCTTGGCTGGGGGTGGGGGG - Intergenic
1001895685 5:175377989-175378011 CTTCCAAGGCTGTGGTTTTTGGG - Intergenic
1004929412 6:20447414-20447436 ATTCCTATGCTGAGGGGTGGGGG - Intronic
1006569493 6:34989309-34989331 CTTCTGAGGTAGAGGGTTGTGGG + Exonic
1007274632 6:40664237-40664259 CTCCCTAGGTTGAAGGCTGTGGG - Intergenic
1010744567 6:79546456-79546478 TTTCCTAGGGTGATGGTTGCTGG - Intergenic
1020525185 7:9250771-9250793 CTTCCTTGGCTGGGGGGTGGGGG - Intergenic
1021253894 7:18365541-18365563 ATTCCTAGGCTAAGGATTATTGG - Intronic
1022516545 7:30978304-30978326 CATCCCAGGCTGAGGCTGGTGGG + Intronic
1022877869 7:34553308-34553330 CTTCATAGGCTGGTGGTAGTGGG - Intergenic
1025833396 7:65074642-65074664 GTTACTAGGCTGTGGGTTTTGGG + Intergenic
1025903159 7:65764151-65764173 GTTACTAGGCTGTGGGTTTTGGG + Intergenic
1030701659 7:112647305-112647327 CTCCCTTGGCTGTGGGGTGTGGG + Intergenic
1033756715 7:144402614-144402636 CTCCCTGAGCTGAGGGTTCTTGG - Intronic
1034268678 7:149792998-149793020 ATTCCTGGGCTGAGGCTTGCGGG + Intergenic
1039436578 8:37563602-37563624 CTTGGGAGGCTGAGGGTTGGAGG + Intergenic
1041742982 8:61176741-61176763 CTCCCTTGGCTGAGGGGTGAGGG - Intronic
1045847847 8:106658219-106658241 CGACCTGGGCTGAGGGCTGTGGG + Intronic
1047934572 8:129764382-129764404 CCGCCTAGGCTGTGTGTTGTAGG + Intronic
1048280388 8:133101429-133101451 CCTCCTTGGCTGATGGTGGTTGG - Intronic
1049016629 8:139924580-139924602 ATTCCTAGGCTAAGAGTTGAAGG - Intronic
1049844006 8:144791341-144791363 CTTCTTGGTCTCAGGGTTGTGGG + Exonic
1050456407 9:5838998-5839020 CTTCCTAGGCACAGGGTTGCTGG - Intergenic
1050656441 9:7833621-7833643 CTTCCTAGGTGGAGGGTGGTGGG + Intronic
1053141448 9:35685179-35685201 CATCCTAGGCTTGGGGCTGTAGG - Intronic
1053314754 9:37041871-37041893 CATTCCAGGCTGAGGGTGGTTGG - Intergenic
1055395096 9:75865722-75865744 TTTTCCAGGCTGAGGGTGGTTGG - Intergenic
1055755946 9:79557358-79557380 CCTCTTGGTCTGAGGGTTGTGGG - Intergenic
1057182960 9:93039785-93039807 CCTCTTAGGCTGGGGCTTGTGGG - Intergenic
1060442753 9:123656706-123656728 CTTCCTAGGCTTAGTGTCCTGGG + Intronic
1061487742 9:130928882-130928904 CTTCATAGGATGAGGGATTTGGG - Intronic
1062059902 9:134489663-134489685 CTTCCTGGGCTGATTGTGGTGGG + Intergenic
1185952397 X:4451569-4451591 CTCCCTTGGCTGAGGGTTGGGGG - Intergenic
1189204802 X:39228492-39228514 CTCCCTAGGCAGAGGTTTGCAGG - Intergenic
1193566899 X:83087661-83087683 CCTCCCATTCTGAGGGTTGTTGG + Intergenic
1195555098 X:106212629-106212651 TCTGCTAGGCTGAGGGTTGAGGG - Intergenic
1197030195 X:121803383-121803405 CTCCCTTGGCTGGGGGTTGGGGG + Intergenic
1197049647 X:122042880-122042902 CTCCCTTGGCTGGGGGTTGGGGG + Intergenic
1199500638 X:148501769-148501791 CTTTCAAGACTGAGGGTTTTCGG + Intronic
1201738985 Y:17303634-17303656 CTCCCTTGGCTGAGGGGTGAGGG - Intergenic
1202584676 Y:26410005-26410027 CCTTCCAGGCTGAGGGCTGTGGG + Intergenic