ID: 1114278677

View in Genome Browser
Species Human (GRCh38)
Location 14:21170122-21170144
Sequence GGCTCACTTGGAAGAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114278677_1114278681 0 Left 1114278677 14:21170122-21170144 CCAGTCTCTCTTCCAAGTGAGCC No data
Right 1114278681 14:21170145-21170167 CTTGACTCCCGATCCCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114278677 Original CRISPR GGCTCACTTGGAAGAGAGAC TGG (reversed) Intergenic
No off target data available for this crispr