ID: 1114278677 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:21170122-21170144 |
Sequence | GGCTCACTTGGAAGAGAGAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1114278677_1114278681 | 0 | Left | 1114278677 | 14:21170122-21170144 | CCAGTCTCTCTTCCAAGTGAGCC | No data | ||
Right | 1114278681 | 14:21170145-21170167 | CTTGACTCCCGATCCCCAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1114278677 | Original CRISPR | GGCTCACTTGGAAGAGAGAC TGG (reversed) | Intergenic | ||