ID: 1114278681

View in Genome Browser
Species Human (GRCh38)
Location 14:21170145-21170167
Sequence CTTGACTCCCGATCCCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114278677_1114278681 0 Left 1114278677 14:21170122-21170144 CCAGTCTCTCTTCCAAGTGAGCC No data
Right 1114278681 14:21170145-21170167 CTTGACTCCCGATCCCCAAGTGG No data
1114278676_1114278681 16 Left 1114278676 14:21170106-21170128 CCATATGAAGAGGAGACCAGTCT No data
Right 1114278681 14:21170145-21170167 CTTGACTCCCGATCCCCAAGTGG No data
1114278675_1114278681 25 Left 1114278675 14:21170097-21170119 CCACAGTAACCATATGAAGAGGA No data
Right 1114278681 14:21170145-21170167 CTTGACTCCCGATCCCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114278681 Original CRISPR CTTGACTCCCGATCCCCAAG TGG Intergenic