ID: 1114280747

View in Genome Browser
Species Human (GRCh38)
Location 14:21191061-21191083
Sequence CTGGAGAAAGAATTGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114280747_1114280756 0 Left 1114280747 14:21191061-21191083 CCAAGCCCCAATTCTTTCTCCAG No data
Right 1114280756 14:21191084-21191106 CCAAAGAACTGGAAAATGGGTGG No data
1114280747_1114280757 9 Left 1114280747 14:21191061-21191083 CCAAGCCCCAATTCTTTCTCCAG No data
Right 1114280757 14:21191093-21191115 TGGAAAATGGGTGGCCTAGTAGG No data
1114280747_1114280754 -3 Left 1114280747 14:21191061-21191083 CCAAGCCCCAATTCTTTCTCCAG No data
Right 1114280754 14:21191081-21191103 CAGCCAAAGAACTGGAAAATGGG No data
1114280747_1114280753 -4 Left 1114280747 14:21191061-21191083 CCAAGCCCCAATTCTTTCTCCAG No data
Right 1114280753 14:21191080-21191102 CCAGCCAAAGAACTGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114280747 Original CRISPR CTGGAGAAAGAATTGGGGCT TGG (reversed) Intergenic
No off target data available for this crispr