ID: 1114287384

View in Genome Browser
Species Human (GRCh38)
Location 14:21257929-21257951
Sequence ATGTTTAGGTAGATGTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114287384_1114287387 18 Left 1114287384 14:21257929-21257951 CCAAGATACATCTACCTAAACAT 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1114287387 14:21257970-21257992 ACACATCTTTAAGCCATTTAAGG 0: 1
1: 0
2: 0
3: 12
4: 175
1114287384_1114287388 24 Left 1114287384 14:21257929-21257951 CCAAGATACATCTACCTAAACAT 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1114287388 14:21257976-21257998 CTTTAAGCCATTTAAGGTGTTGG 0: 1
1: 0
2: 2
3: 12
4: 129
1114287384_1114287389 25 Left 1114287384 14:21257929-21257951 CCAAGATACATCTACCTAAACAT 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1114287389 14:21257977-21257999 TTTAAGCCATTTAAGGTGTTGGG 0: 1
1: 0
2: 0
3: 24
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114287384 Original CRISPR ATGTTTAGGTAGATGTATCT TGG (reversed) Intronic
901872338 1:12145399-12145421 ATGTTTAGGAAGAGGTGTGTGGG - Intergenic
903664280 1:24996957-24996979 ATGGTTAGGCAGAGTTATCTGGG + Intergenic
904969505 1:34408115-34408137 ATGTTTAGGTCAAGGTCTCTTGG - Intergenic
905381365 1:37563841-37563863 ATCTTTAGGTAGGTCTATCCTGG - Intronic
905715395 1:40145266-40145288 AAATTTAGGAAGATGAATCTCGG + Intergenic
906006154 1:42472933-42472955 ATGTGTATGTATATATATCTTGG - Intronic
908021915 1:59906778-59906800 ATATTTAGGTATATGCATCCAGG - Intronic
911665990 1:100552610-100552632 ATGTTATGTTATATGTATCTAGG + Intergenic
913104556 1:115600500-115600522 ATCTTTAAGTAGATATATTTAGG - Intergenic
918550853 1:185740579-185740601 GTGTTTAGGTAGATCTCTCATGG + Intronic
918648616 1:186931207-186931229 ATCTTTATATAGATGTATATGGG - Intronic
924465965 1:244299529-244299551 ATCGTTAGGAAGATGCATCTTGG + Intergenic
1068668572 10:59701354-59701376 CGGTTTAGGAAGATGGATCTGGG - Intronic
1069449935 10:68508866-68508888 ATGATAAGGTAGAAGTATCGAGG + Intronic
1071048446 10:81414820-81414842 ATGTTTAGGTAGTTGTAGATTGG - Intergenic
1071333503 10:84583717-84583739 ATGTTTAGGGAGTTGTGCCTGGG + Intergenic
1071636732 10:87263538-87263560 TTATTTACATAGATGTATCTTGG + Intergenic
1071658517 10:87474416-87474438 TTATTTACATAGATGTATCTTGG - Intergenic
1076233550 10:128844648-128844670 ATATATAGGTGGATCTATCTTGG - Intergenic
1078573556 11:12479816-12479838 CTGTTTAGGTAAATGTGTATAGG + Intronic
1085455032 11:76660778-76660800 AAGTTCAGGTAGATGAGTCTCGG + Exonic
1086147079 11:83563743-83563765 ATTTTTAATTAGATGAATCTTGG - Intronic
1092373339 12:7935133-7935155 ATTTTTAGTTAAATTTATCTTGG + Intronic
1093586415 12:20842458-20842480 ATGTTTATGTAAATCTATTTGGG + Intronic
1095195156 12:39305710-39305732 ATGTTTAGGTGGATTTAGGTTGG - Intronic
1096655815 12:53091402-53091424 CTATTTATGTAGATGTAACTGGG - Intergenic
1099388279 12:82046263-82046285 ATGTTAAGGAAAATGAATCTGGG + Intergenic
1101115756 12:101529786-101529808 ATGTTTAGGCTGATGTATAAAGG - Intergenic
1102749071 12:115276475-115276497 ATGTTTAGGTAGAAGAGCCTGGG - Intergenic
1103163241 12:118748598-118748620 ATTTTTGGTTAGTTGTATCTAGG + Intergenic
1107157500 13:37186487-37186509 TTATTTAGGTAGAGTTATCTGGG + Intergenic
1107768537 13:43764239-43764261 ATGTTTTTGTAGATGTTTCAGGG - Intronic
1108023341 13:46152062-46152084 ATGTTTTGGTATACTTATCTTGG + Intronic
1109837611 13:67878978-67879000 ATGTTTATTTAGATATATTTAGG - Intergenic
1110466645 13:75809475-75809497 AAGATTAGGTATATGTATTTTGG + Intronic
1113354018 13:109560823-109560845 ATGTATCTGTACATGTATCTAGG + Intergenic
1113354020 13:109560850-109560872 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354022 13:109560877-109560899 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354024 13:109560904-109560926 ATGTATCTGTACATGTATCTGGG + Intergenic
1114287384 14:21257929-21257951 ATGTTTAGGTAGATGTATCTTGG - Intronic
1115999132 14:39224444-39224466 AAGCTTAAATAGATGTATCTTGG - Intergenic
1116189885 14:41650658-41650680 ATATTTATGTAGATTTATATGGG + Intronic
1116652760 14:47614774-47614796 ATGTTAAGGTACATGTTTCCAGG + Intronic
1119123578 14:72102303-72102325 TTGTTTATGTAAATGTATTTTGG - Intronic
1119943873 14:78670713-78670735 ATTTTTAGGTGGATATAACTGGG + Intronic
1121816030 14:96929187-96929209 ATGGTTAGGTAGATGGATGGGGG - Intronic
1123892970 15:24799953-24799975 ATGTTTATGTAGATATATATGGG - Intergenic
1126267092 15:46767729-46767751 ATGTATAGATATATTTATCTTGG + Intergenic
1126665356 15:51071136-51071158 ATGTTTATGTATATGTTTTTAGG - Intronic
1126917460 15:53482123-53482145 ATGGTTGGGTAGATGGTTCTGGG - Intergenic
1128042830 15:64590686-64590708 ATGTATATATATATGTATCTGGG + Intronic
1128409810 15:67383592-67383614 ATGTTTAGAAAGATGTATTGTGG - Intronic
1133138228 16:3727126-3727148 ATGTATAGATAGATGTGTGTGGG + Exonic
1135151876 16:20014693-20014715 ATGTTTAAATAAATGTATCATGG + Intergenic
1137839222 16:51624642-51624664 GTTTCTAGATAGATGTATCTAGG - Intergenic
1140211378 16:72973314-72973336 GTGTTTTGGTAGTTGTTTCTTGG - Intronic
1140772767 16:78221033-78221055 ATCTTTAAGTAGGTGAATCTTGG + Intronic
1140865379 16:79056431-79056453 AAGGATAGGTAAATGTATCTGGG + Intronic
1149334702 17:55623675-55623697 AATTTTAGGATGATGTATCTTGG + Intergenic
1152998257 18:428577-428599 ATGTTTAGGTACAGGTCTTTGGG + Intronic
1153935426 18:9915883-9915905 ATTTTTACGTAGTTGTAGCTGGG + Intronic
1155783366 18:29868350-29868372 GTGTGTGGGTATATGTATCTAGG + Intergenic
1162369713 19:10271303-10271325 ATGCTTAGGTAGCTGTTTATGGG + Intronic
1165537444 19:36461363-36461385 AGTTTTAATTAGATGTATCTTGG - Intronic
1168109222 19:54182210-54182232 ATGTTTAGGTCAATGTAGCATGG + Intronic
1168445841 19:56412273-56412295 ATGGTTAGGCATATGCATCTTGG - Intronic
925335645 2:3097455-3097477 TTGTTTAGGTTGATTTATTTAGG + Intergenic
927725580 2:25419943-25419965 GTGTTTAGGTACATTTATCGAGG + Intronic
928872992 2:36003507-36003529 ATGTTTATTTATATGTGTCTGGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930576062 2:53150299-53150321 ATGTTTATGTGGCTGTTTCTGGG - Intergenic
932763211 2:74453769-74453791 ATATTTAGATATATGTATATAGG + Intergenic
933556154 2:83833405-83833427 ATGTGTACGTATATGTATATAGG - Intergenic
936226002 2:110652697-110652719 ATGTTTAGGTAGATATTGATTGG - Intronic
936947841 2:117946535-117946557 CTGTTTAGGGAGATGTTTCTGGG - Intronic
940419380 2:153461552-153461574 ATGTCTAGGCAGATGAGTCTGGG + Intergenic
944139744 2:196443056-196443078 ATGTTTAGGTGGATTGATCCTGG - Intronic
1169833362 20:9850586-9850608 ATGTATATGTATATGTATGTAGG - Intergenic
1171540318 20:25945874-25945896 CTGTTTACGGAGATGTAGCTAGG - Intergenic
1171843348 20:30242246-30242268 CTGTTTATGGAGATGTAGCTAGG - Intergenic
1173419008 20:42884062-42884084 ATGTTTAAGCAGAGGTGTCTTGG + Intronic
1175575772 20:60059581-60059603 ATGTTTACATAGGTGTATGTGGG - Intronic
1175723111 20:61299512-61299534 ATGTTGACTTAGATGTTTCTTGG + Intronic
1177084455 21:16685594-16685616 ATGTTTAGGTGGGTGTGTGTGGG - Intergenic
1177670756 21:24223212-24223234 ACATTTAGGTAGAAGTATATTGG + Intergenic
1182088339 22:27576892-27576914 ATGGATAGGTGGATGTGTCTAGG + Intergenic
1182590719 22:31377578-31377600 TTGTTTAGGCAGATTTATTTTGG + Intergenic
949705186 3:6808386-6808408 ATGTGTAGTAAGATGTGTCTAGG + Intronic
951150444 3:19283479-19283501 ATGTTGAGATAAATATATCTAGG - Intronic
951806044 3:26644865-26644887 ATGTTTATGTATGTGTATTTTGG - Intronic
952249751 3:31640534-31640556 ATGTTTAGTTTGATATTTCTAGG + Intergenic
955782368 3:62498617-62498639 ATATTTATTTAGATGTATGTTGG + Intronic
956573334 3:70722022-70722044 GTGTTCTGGTGGATGTATCTAGG - Intergenic
957357294 3:79108205-79108227 ACATTTATGTCGATGTATCTTGG - Intronic
962391189 3:134974152-134974174 GGATTTAGGAAGATGTATCTGGG - Intronic
970076384 4:12226059-12226081 ATGTTTATGTGTATGTATATTGG + Intergenic
970253613 4:14143442-14143464 ATCTTTTGATAGTTGTATCTTGG - Intergenic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
972168881 4:36320930-36320952 ATATTTACATATATGTATCTAGG + Intronic
972223313 4:36981740-36981762 ATGTTTAAGTGTATGTATGTTGG - Intergenic
972638722 4:40907008-40907030 GTGTATATGTAGATGGATCTAGG + Intronic
973169857 4:47128168-47128190 AAGTTGAGGTAGTTATATCTTGG + Intronic
974257596 4:59480506-59480528 ATATTTAGGTGGTTGGATCTTGG - Intergenic
975589783 4:75988392-75988414 ATGTTTAGGAAGAATGATCTAGG - Intronic
975759079 4:77600122-77600144 ATGATTAGTGAGAAGTATCTAGG + Intronic
977147893 4:93468928-93468950 ATGTTTAGGTAGATACATGCTGG + Intronic
978087766 4:104675312-104675334 ATGTTTAGGGAAATGTATATTGG - Intergenic
979755046 4:124329905-124329927 ATGTTTACGTTGCTTTATCTTGG + Intergenic
979991869 4:127384333-127384355 ATGTGTATGTATATGTATATAGG - Intergenic
980264484 4:130497424-130497446 ATGTTTAGGTTGATGTAGGTGGG + Intergenic
983142181 4:164164813-164164835 ATGTATAGGTAAATCTATCATGG + Intronic
983745388 4:171192160-171192182 ATGTTTAGGAATATGTGTGTAGG - Intergenic
985066123 4:186124135-186124157 ATTATTCTGTAGATGTATCTTGG - Intronic
985319898 4:188699168-188699190 ATGTTCAGGTACCTGAATCTGGG + Intergenic
987261868 5:16212376-16212398 ATATTTAGCTATGTGTATCTAGG - Intergenic
988163792 5:27556387-27556409 ATGTGTATGTGTATGTATCTGGG + Intergenic
990090481 5:52040631-52040653 GTATTTAGGTATATGTATATAGG - Intronic
990627106 5:57626377-57626399 ATGTCCAGGTAGAGGTATCCAGG - Intergenic
990883181 5:60563180-60563202 ATGTTTAGGCAAATATATCCTGG - Intergenic
992094326 5:73347114-73347136 ATGTTTTGATTGATGTATCTAGG - Intergenic
993150825 5:84160343-84160365 GTGTCTAGGAAGATGAATCTGGG + Intronic
1000601977 5:163286025-163286047 ATGTTTAGGGACATGTATTGTGG - Intergenic
1004342014 6:14816286-14816308 ATGTTTAATTGGATTTATCTTGG - Intergenic
1004843113 6:19609890-19609912 ATATTTAGGTAGCGGAATCTGGG + Intergenic
1006005569 6:30999250-30999272 ATGTTTAGGAAGATGTTCTTTGG + Intergenic
1006877993 6:37315212-37315234 ATTTTTAAGTATATATATCTTGG + Intronic
1009873202 6:69473649-69473671 ATGTGTATGTAGATGCAGCTAGG - Intergenic
1011582261 6:88882134-88882156 ATATTTAGGTAGTTGGACCTTGG - Intronic
1014077717 6:117256005-117256027 TTGTATAGGTATATGTATATGGG - Intergenic
1014106665 6:117572107-117572129 ATGTCCAGTTGGATGTATCTTGG + Intronic
1014303210 6:119709556-119709578 CTGTTAAGGTAAATTTATCTAGG - Intergenic
1014846591 6:126284972-126284994 ATATTTAGATAAAAGTATCTGGG + Intergenic
1016030332 6:139330705-139330727 ATATTTAGTTAGATATATATTGG - Intergenic
1016145105 6:140661036-140661058 ATGTTTAAGCTGATTTATCTAGG - Intergenic
1016234549 6:141847415-141847437 ATGTTTGGGTAGCTGGATTTGGG + Intergenic
1016304354 6:142667984-142668006 ATGTTTAGATAGATTGATCTTGG - Intergenic
1019961570 7:4464859-4464881 ATGATTATGTAGAAGTGTCTTGG - Intergenic
1023919524 7:44616537-44616559 ATGTTTAGGTTTAAATATCTTGG + Intronic
1024851114 7:53718244-53718266 ATGATGAGGAAGCTGTATCTGGG + Intergenic
1024928685 7:54646117-54646139 ATGTTTAGAAAAATGTTTCTGGG - Intergenic
1025219782 7:57097327-57097349 ATTTTTATGTATTTGTATCTAGG - Intergenic
1025291751 7:57732116-57732138 CTGTTTACGGAGATGTAGCTAGG - Intergenic
1026432582 7:70361872-70361894 ATGTATATGTATATGTATATAGG + Intronic
1028324661 7:89507400-89507422 TTATTTAGGTAAATGTCTCTAGG - Intergenic
1030700665 7:112636273-112636295 AGATTTAGGTACATCTATCTTGG - Intergenic
1032127412 7:129205127-129205149 TTGTTTAGGGAAAGGTATCTAGG - Intronic
1034144022 7:148852472-148852494 ATGTCTAGGGAGATGTACCTTGG - Intronic
1038088496 8:24227365-24227387 ATGTATATGTATATGTATATGGG + Intergenic
1038323473 8:26551066-26551088 ATGTCTATGAAGGTGTATCTGGG - Intronic
1038775974 8:30530913-30530935 ATGTTTTGGTAGGTAGATCTAGG - Intronic
1041528455 8:58835762-58835784 ATGATTAGGAAAATGTAACTGGG + Intronic
1043121711 8:76333542-76333564 ATGCTTAGGTAGGTGTCTATGGG + Intergenic
1043588358 8:81795930-81795952 ATGTTTACAAAGATGTTTCTCGG - Intergenic
1045875335 8:106975155-106975177 ATGCTTAGGTAGATGAAGCATGG + Intergenic
1047917835 8:129602151-129602173 ATGTTTAAGTAGTTCTATTTTGG - Intergenic
1048075159 8:131061977-131061999 ATGCTTAGGTTGATGTCCCTAGG - Intergenic
1048195614 8:132329618-132329640 ATGGTTAGTTAGAGCTATCTGGG - Intronic
1050249247 9:3726946-3726968 ATGTTGAGTTGGATGGATCTTGG - Intergenic
1051005994 9:12345397-12345419 ATGTTTGGATATATGTATATAGG - Intergenic
1052223971 9:26061588-26061610 ATGTTCAGGTAGGAATATCTTGG - Intergenic
1054164748 9:61713585-61713607 CTGTTTACGGAGATGTAGCTAGG + Intergenic
1054943571 9:70770710-70770732 CTTTTTAGGTTGATGTATTTGGG + Intronic
1054957775 9:70933182-70933204 ATATTAAGGTAGAGATATCTAGG + Intronic
1055217944 9:73890287-73890309 ATATTTTGCCAGATGTATCTAGG + Intergenic
1055798951 9:80010521-80010543 ATGTTTTGCTACATGTATTTTGG + Intergenic
1059691815 9:116692292-116692314 TTATTTAGGTTTATGTATCTGGG + Intronic
1060575507 9:124688810-124688832 GTGTTTATGTACATGTATTTAGG + Intronic
1186087071 X:6002362-6002384 ATATTCAGGTGGATGGATCTTGG + Intronic
1186461552 X:9752411-9752433 ATCTTTAGGGAAATGTATTTGGG - Intronic
1188734343 X:33694116-33694138 ATGATTAGGTAGATGGATAGGGG - Intergenic
1188747904 X:33869591-33869613 CTGTTGAGGTAGAACTATCTAGG - Intergenic
1188783547 X:34314821-34314843 ATGTTTGGGTAAATGCATTTGGG - Intergenic
1189945093 X:46169769-46169791 ATTTTTAGCTACATGTATGTTGG + Intergenic
1193503898 X:82315903-82315925 ATATTTATGTAGATCTATTTTGG - Intergenic
1195870880 X:109484108-109484130 ATTTATAGGTAGAAGTAGCTGGG + Intergenic
1196242468 X:113358868-113358890 ATGTTTAGGAATATGTATAGTGG - Intergenic
1197159529 X:123307986-123308008 AAATTTATGTAGATGGATCTAGG - Intronic
1198601242 X:138286289-138286311 AGGTTTATGTAGATGCAACTAGG - Intergenic
1199063784 X:143390021-143390043 ATATTTAGGTAGACGTCCCTTGG + Intergenic