ID: 1114287930

View in Genome Browser
Species Human (GRCh38)
Location 14:21262746-21262768
Sequence CAAGGGAAACAGGAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1163
Summary {0: 1, 1: 1, 2: 9, 3: 139, 4: 1013}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114287930 Original CRISPR CAAGGGAAACAGGAGGAAGA TGG Intronic
900103900 1:974140-974162 GGAGGGAAACAGGAGGACGGGGG + Intronic
900214767 1:1475522-1475544 CAAGGGACAGAGGAGGCAGTCGG - Intronic
900221979 1:1513878-1513900 CAAGGGACAGAGGAGGCAGTCGG - Intronic
900717290 1:4153183-4153205 CCAGGGAGACATGAGGACGAAGG + Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
902069838 1:13724833-13724855 AAAAGGAAGGAGGAGGAAGAGGG + Intronic
902094361 1:13930491-13930513 AAAGGGAAAAAGGGGGAAAATGG - Intergenic
902606669 1:17572997-17573019 CAAGGGAAACAGTAGGATTTGGG - Intronic
902847577 1:19123973-19123995 CACTGGCAGCAGGAGGAAGAAGG + Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904208106 1:28868034-28868056 CCATGGAAACTGGAGGAGGAGGG + Intergenic
904317080 1:29672510-29672532 AAAGGCAAGCAGGAGGAAAAGGG + Intergenic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904357151 1:29947734-29947756 CAAGGAAAAGAAGAGGAGGAAGG - Intergenic
904442931 1:30543456-30543478 CAAAGGAAACAGGAGTGACATGG + Intergenic
904464678 1:30700812-30700834 CAGGGGAAACAGGAGCGAGGGGG + Intergenic
904637901 1:31898623-31898645 CAAAGGAAACAGAAGTAACATGG + Intergenic
904848825 1:33441508-33441530 GAAGGGGAGGAGGAGGAAGAAGG - Intergenic
904914394 1:33959608-33959630 CAAGGGCAGCAGGAGGGAGAGGG - Intronic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905346991 1:37318100-37318122 CAAGGGCAACGGGAGGAGGAAGG - Intergenic
905580544 1:39080892-39080914 TAAGGGAAACGGGCGAAAGAGGG + Intergenic
905873926 1:41420220-41420242 CAAGGGAGACTGCAGGAAGCTGG - Intergenic
906146539 1:43563963-43563985 CCAGGGAAACCCGAGGAAGGAGG + Intronic
906192104 1:43905241-43905263 GAAGAGGAACAGGAGGAGGAGGG - Intronic
907021449 1:51070235-51070257 GAAGGAAAACAGGAGGGACAAGG - Intergenic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907726257 1:57023503-57023525 GAAGGGAAGCTGGTGGAAGAGGG + Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908123127 1:61004547-61004569 CAAGGCAAAAGGGAGAAAGAGGG + Intronic
908897662 1:68918680-68918702 GAAGGTGAAGAGGAGGAAGAGGG + Intergenic
909681035 1:78292534-78292556 CCAGTGAAACAGGAGGAGAAGGG + Intergenic
910216579 1:84850095-84850117 CAGAGGAGACAGGCGGAAGAAGG + Intronic
910707635 1:90146679-90146701 AAAAGGAAAAAGAAGGAAGAGGG + Intergenic
910985907 1:93004284-93004306 AAAGAGAAATAGGAGGAAGATGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911171973 1:94779928-94779950 AAAGGGAGAGAGGAGGGAGAAGG - Intergenic
911174609 1:94806645-94806667 GGAGGGAAAGAAGAGGAAGAGGG - Intergenic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
911727845 1:101260987-101261009 CAAGGAAATCACAAGGAAGAAGG - Intergenic
912161664 1:106992980-106993002 CAAGGGAGAAGGGAGGGAGACGG + Intergenic
912614594 1:111085478-111085500 CAAGGGGGACAGGGGGAACATGG + Intergenic
912744977 1:112238644-112238666 GAAGGAAATGAGGAGGAAGATGG - Intergenic
913186370 1:116373566-116373588 CGAGGGGAAGAGGAGGAAGTCGG + Intronic
913215355 1:116615535-116615557 TGAAGGAAACATGAGGAAGAGGG - Intronic
914805115 1:150985902-150985924 AAAGGGAAACAGATGCAAGAAGG - Intronic
914971996 1:152314433-152314455 CAAGAGAAACAGGGGGGAAAAGG - Exonic
915864223 1:159481112-159481134 CAAAGTCAAAAGGAGGAAGACGG + Intergenic
915885367 1:159715961-159715983 AAAGGGAAAAAGGGGGAAGTGGG - Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
916204068 1:162298280-162298302 CATGGGAAACGGGAGCAAGAAGG - Intronic
916493780 1:165326705-165326727 GACAGGAAACAGGATGAAGAGGG - Intronic
916666503 1:166972691-166972713 AAAGAGAAACAGGAGGAGAAGGG + Intronic
917001712 1:170367930-170367952 CAAGGAGAACAAGAGGAGGATGG - Intergenic
917189527 1:172400137-172400159 GGAGGAAATCAGGAGGAAGAAGG - Intronic
917500387 1:175579868-175579890 AAAGGGAAAGGGAAGGAAGAAGG - Intronic
917514165 1:175693278-175693300 CAAGGGAGACAGGTGGATGGTGG - Intronic
917619178 1:176778288-176778310 CAAGGAAAATAGGGGAAAGAGGG + Intronic
918045399 1:180938178-180938200 CAAGGGACACAGTGGGAACAGGG - Intronic
918478468 1:184951662-184951684 CAAGCCAAACAGGAAGAAGCTGG - Intronic
918511324 1:185316998-185317020 GATGGGAAGCAGGAGGAAGCGGG + Exonic
919071185 1:192756947-192756969 CAAAGGAAGCAGGAAGAAGATGG - Intergenic
919611999 1:199756946-199756968 CAAACAAAGCAGGAGGAAGAAGG - Intergenic
919728576 1:200899151-200899173 GAAGGAAAAGAGGAAGAAGAAGG + Intronic
920020965 1:202956467-202956489 CAAGGCAAAGAGGAGTCAGAGGG + Intronic
920045436 1:203129348-203129370 CCAGAGAAACAGGAGGGGGATGG + Intronic
920206959 1:204299246-204299268 GAAAGCAAACAGGAGGAAGAAGG + Intronic
920348288 1:205321016-205321038 CAATGGAAAGAGGAAGTAGAAGG - Intronic
920360875 1:205415270-205415292 GAAGGGAAAGAGAAGGAAAAGGG + Intronic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920435768 1:205946062-205946084 CTAGGGAAACAGAAGACAGAAGG + Intergenic
920529604 1:206692388-206692410 CCAAGGAAGCAGGAGGAAAAGGG + Intronic
920572052 1:207024772-207024794 CAAGGGTCACAGGCAGAAGAAGG - Intronic
920586394 1:207166974-207166996 ACAGGGAAACAGAAGGAAAAGGG - Intergenic
920940459 1:210477348-210477370 CTAGGGAAACAGTGGGAAGAAGG - Intronic
921118159 1:212113962-212113984 CAAGGGAAGCAGGAAGGAAAGGG + Intergenic
921184145 1:212655787-212655809 GAAGGGATACAGGATGAGGAAGG - Intergenic
921334391 1:214071842-214071864 CAAGGGAAGCAAGAAAAAGAGGG - Intergenic
921572773 1:216798462-216798484 CAAGGGAAAGAGGATGAAAAAGG + Intronic
921650558 1:217673402-217673424 ACAGAGAAACAGGAGGAACAGGG - Intronic
921934533 1:220785063-220785085 CAAAGGAAAATGGAGGAGGAGGG - Intergenic
922190735 1:223316448-223316470 CATGGGAACCTGGAGGAAGGGGG + Intronic
922229270 1:223671639-223671661 CAAGGGGAACAGCAAGAAAATGG + Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922362283 1:224834122-224834144 CCAGGGGCACAGGAGGAGGAAGG - Intergenic
922367332 1:224878289-224878311 CTTGGGAATAAGGAGGAAGAGGG - Intergenic
923280157 1:232436097-232436119 CTAGGGAAGCAGGAGGAATGTGG - Intronic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923482329 1:234397200-234397222 GAAGGGGAAGAGGAGGAGGAGGG + Intronic
923526266 1:234775236-234775258 CACAGGAAACAGCAGCAAGATGG - Intergenic
924020270 1:239773713-239773735 CAAGGGAAATAAGATGAAGATGG + Intronic
924275128 1:242378348-242378370 CTAGGGAAAAAGGAGGAATGGGG + Intronic
924863262 1:247949465-247949487 GAAGGGAAACACGAGAAAGATGG - Exonic
924865521 1:247975329-247975351 AAAGGTAAACATGAGAAAGAGGG - Intronic
924867721 1:248003738-248003760 GAAGGGAAACACGAGAAAGATGG - Intronic
924869208 1:248022555-248022577 GAAGGGAAACACAAGAAAGATGG - Exonic
924872259 1:248061289-248061311 GAAGGGAAACACGAGAAAGATGG - Exonic
1063182645 10:3619113-3619135 CCCTGGAAACAGGAGGAGGAGGG + Intergenic
1063299021 10:4835209-4835231 AAAGGTACACAGGAGGTAGAGGG - Intronic
1063872088 10:10428658-10428680 CAAGGAAAAGAGTGGGAAGAGGG - Intergenic
1063988222 10:11530785-11530807 CAAGGCAAACAGTAAGAAGCAGG + Intronic
1065781201 10:29169613-29169635 GATTGGAAACTGGAGGAAGAGGG - Intergenic
1065916592 10:30358524-30358546 GAAGGGAAAGGGGAGGAAGATGG - Intronic
1066084105 10:31960194-31960216 AAAGGGAAAGAGGAAAAAGAAGG + Intergenic
1066124517 10:32327313-32327335 GACGGGAAACAGGAAGAAGTTGG + Intronic
1066459569 10:35601414-35601436 TAAGTGAAGCAGGAGTAAGAGGG + Intergenic
1066544424 10:36483682-36483704 CAAAGGAAACAGGATGATAAAGG + Intergenic
1066546201 10:36503131-36503153 CAAGGGGGCCAGGAGGAAGCAGG - Intergenic
1066562960 10:36690446-36690468 CAACTGAGACAGGAGAAAGAGGG + Intergenic
1066652910 10:37676355-37676377 CAAGAGAAACAGCAGGAATGAGG - Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1067650962 10:48154874-48154896 GCTGGGAAACAGGAAGAAGAAGG - Intergenic
1067902113 10:50253046-50253068 CAAGGGAGAAAGGTGGGAGAAGG - Intergenic
1068082369 10:52335368-52335390 CAGGGGAGACAGGATGAAGCAGG + Intergenic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1068771281 10:60824526-60824548 CAAGTGAATCAGGTGCAAGAGGG + Intergenic
1069786599 10:70992351-70992373 CTAGGGCAACAGGAGTAAGCAGG + Intergenic
1069887219 10:71631404-71631426 GAAGGGGAAGAGGAGCAAGAGGG + Intronic
1069943820 10:71972802-71972824 CAAGGGGAAAAGGGGGAAGGAGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070247873 10:74748956-74748978 CAAGGGAAGCCAGAGGCAGAGGG + Intergenic
1070333633 10:75435724-75435746 CAAAGGAAACAGGAGCACCAAGG - Intronic
1070603399 10:77881435-77881457 AAAGGGAAGCATGAGAAAGAAGG + Intronic
1070637413 10:78140364-78140386 AAAGGGAAACAGTGAGAAGAGGG + Intergenic
1071441609 10:85702880-85702902 GAAGGAAAAGAGGAGGAAGACGG + Intronic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1071948552 10:90676498-90676520 TAATGGAAACAGAAGGGAGAAGG - Intergenic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072797193 10:98365112-98365134 GAAGAGAAAAAGGAGGGAGAAGG + Intergenic
1072899553 10:99394959-99394981 CAAAGCAAACAGGAGGATCAGGG + Intergenic
1073142866 10:101260768-101260790 CTAGGGAAACTGGAGGTAGTGGG + Intergenic
1073146703 10:101285976-101285998 CAAGGGAAAGAGGAGGCAGAGGG - Intergenic
1073340906 10:102743962-102743984 GAAGGGAAGAAGGAAGAAGAGGG + Exonic
1073787056 10:106901169-106901191 CAAGGGAGTCAGCAGGAACAGGG + Intronic
1074013607 10:109509403-109509425 AAAGCTAATCAGGAGGAAGAGGG - Intergenic
1074115089 10:110450870-110450892 TAAGGGAGGCAGGAAGAAGAAGG + Intergenic
1074289061 10:112124597-112124619 GAAGGGGAAGAGGAAGAAGAGGG - Intergenic
1074833582 10:117267540-117267562 TGAAGAAAACAGGAGGAAGAAGG - Intronic
1074934810 10:118167379-118167401 AAAGCCAAACAGGAGGAAGATGG - Intergenic
1075663935 10:124217557-124217579 CAATGCTAACAAGAGGAAGAAGG + Intergenic
1075684462 10:124353997-124354019 CAAGGGACCCAGGAGGGAGATGG - Intergenic
1075847208 10:125554654-125554676 CAAGATTGACAGGAGGAAGATGG - Intergenic
1075851962 10:125596361-125596383 GAAAGGGAAGAGGAGGAAGAGGG + Intronic
1076129379 10:128002291-128002313 CAAGGCCATCAGGAGGAAGTGGG + Intronic
1076139817 10:128069999-128070021 CGAGGGAAAGATGAGGACGAGGG - Intronic
1076190825 10:128482247-128482269 CAAGTGAAATGGGAGGAAGGTGG - Intergenic
1077003841 11:341120-341142 AAAAGGAAAGAGGAGGAAGGAGG + Intergenic
1077094778 11:794660-794682 GAAGGGAAACGGGAGGCAGGCGG - Intronic
1077163240 11:1123068-1123090 GGAGGGAATCAGGAGGAAGGAGG - Intergenic
1077980629 11:7296571-7296593 AAAGAGACACAGGAAGAAGAAGG - Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078612930 11:12837669-12837691 GAAGGGAGAAAGAAGGAAGAAGG - Intronic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1078729771 11:13963864-13963886 CAAGGGGAATTGGATGAAGATGG + Intronic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080931624 11:36817411-36817433 CAAGGGAATCAGTGGGGAGATGG - Intergenic
1080971046 11:37277360-37277382 AAAGGGAAAAAGAAGGAAGGAGG - Intergenic
1081008329 11:37775452-37775474 CAAGAGAAAAATGAGGAAGAAGG + Intergenic
1081882463 11:46465256-46465278 CCAGGGAGTCAGGAGGCAGAAGG - Intronic
1082001512 11:47395736-47395758 CCAGGGAGGCAGGAGGAAGGAGG - Intergenic
1082731293 11:56801128-56801150 CAAGTGACACAGTAGGAAAATGG - Intergenic
1082798686 11:57397563-57397585 CTATGGTAAGAGGAGGAAGAGGG - Intronic
1083015437 11:59448255-59448277 CCAGGAAAACAGGAGGAAAAGGG + Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083337386 11:61931655-61931677 GAAGGCAAGGAGGAGGAAGAAGG + Intergenic
1083369474 11:62166835-62166857 AATGGGAAACAGGAGGCAGGAGG + Intergenic
1083429965 11:62609169-62609191 CAAGGGCAGGAGGAGGAAGAGGG + Intronic
1083446203 11:62709439-62709461 AAAGGTAAACAGGCCGAAGAGGG + Intronic
1083614961 11:64021701-64021723 CAAGGGGAAGAGGAGAATGAAGG - Intronic
1083951383 11:65958506-65958528 CAAGGGAAAGAGGATGGGGAGGG + Intronic
1084258691 11:67959799-67959821 AAAAGGAAACAGGAGTCAGAGGG + Intergenic
1085099206 11:73786273-73786295 AAAGGGAAAAAGAAGGAAGAAGG - Intergenic
1085730424 11:78993231-78993253 TAAGGGAGCCTGGAGGAAGAGGG + Intronic
1085804108 11:79618893-79618915 CCAGGGAGACAGGAGGACGTGGG - Intergenic
1086104983 11:83137922-83137944 CAAGGGAAACTTGAAGAATAGGG - Intergenic
1086221797 11:84454228-84454250 CAAAGGAAGGAGGAAGAAGAAGG + Intronic
1086794424 11:91083072-91083094 CAAGAGAAAAATGAGGAAGAAGG - Intergenic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1088056998 11:105595823-105595845 CAAGGCATTCAGGAGGAATATGG - Intergenic
1088087388 11:105997215-105997237 GAAGGGGAAGAGGAGGAGGAAGG + Intronic
1088340373 11:108758716-108758738 AAGTGGAAACAGGAGGCAGAAGG - Intronic
1088489656 11:110374482-110374504 CAAAGAAAAAAGGAGGAAGGAGG - Intergenic
1088646342 11:111919566-111919588 GAAGGGGAAAGGGAGGAAGAGGG - Intronic
1090375646 11:126286936-126286958 CAAGGGAAGCAGGCGGCAGTGGG - Intronic
1090504975 11:127301257-127301279 AAAGGGAAAGAGTAGGAAGGGGG + Intergenic
1090857940 11:130627075-130627097 CAAGGGAAAAAGAAGGACAAAGG + Intergenic
1090910515 11:131114696-131114718 CAAGGGAGACCGAAGGGAGAAGG - Intergenic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091592747 12:1854751-1854773 CAAGGGAAACAGCATGTATAGGG - Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1091776875 12:3190420-3190442 CCTGGAAAACAGGAGAAAGAAGG - Intronic
1091863247 12:3805938-3805960 CAAGTGAAACAGGTGGTAAAGGG + Intronic
1092226908 12:6753462-6753484 AAGGGGAAACTGGAGGACGAGGG + Exonic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092731937 12:11542960-11542982 CCAGGGAAAGAGGAGGGAGTTGG - Intergenic
1092949549 12:13488539-13488561 CCAGGGAAACAAAAGGAAAAGGG + Intergenic
1093191149 12:16076758-16076780 GAAGGAACACTGGAGGAAGAAGG + Intergenic
1093481193 12:19605740-19605762 ACAGGGAAACAAGAGAAAGAAGG + Intronic
1093516997 12:19999559-19999581 CAAGCAAAACAAGAGTAAGATGG + Intergenic
1093698626 12:22192054-22192076 CAAGGGAGACAGTAGGAATAAGG - Intronic
1094129858 12:27063241-27063263 GGAGGAACACAGGAGGAAGAAGG - Intronic
1094331941 12:29303381-29303403 CAAGGAGAGCAGGAGAAAGAGGG - Intronic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095367783 12:41428686-41428708 CCAGGGAATCAGGGGCAAGATGG + Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1095950278 12:47778052-47778074 CAAGGGACAAATGAGGAAGGAGG - Intronic
1096182537 12:49558597-49558619 CAGGGGAAACAGGCCGGAGAGGG + Intronic
1096186820 12:49586987-49587009 CCAGGGTCACAGGAGGCAGATGG + Intronic
1096546641 12:52344705-52344727 CAAATGAAACAGGAGGAGCAAGG + Intergenic
1096560954 12:52435540-52435562 CAAGGTTAACAGGAGAAACAGGG - Intergenic
1097009336 12:55941124-55941146 GGAGGGAAACAGGAGGGAGGGGG + Intronic
1097420202 12:59368338-59368360 AAAGGGCAGCAGGAGGAAGGTGG - Intergenic
1097625429 12:61994370-61994392 AAAAGGCAACAGGAGGAAGGAGG - Intronic
1097632282 12:62078896-62078918 CATGTGCGACAGGAGGAAGAGGG + Intronic
1097957994 12:65506101-65506123 TAAGGGAAAAAGGAGGAAACAGG - Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098524492 12:71470896-71470918 CAAGGGGAACATGGGTAAGATGG - Intronic
1099349965 12:81554162-81554184 AAATGGCAACAGTAGGAAGAAGG + Intronic
1099567230 12:84267755-84267777 CAAGGGAAACCAAAGGAGGAGGG + Intergenic
1100546061 12:95603721-95603743 AAAGGGAAGAAGTAGGAAGAAGG - Intergenic
1100591482 12:96034749-96034771 CCAGGGAACTAGGAGGGAGACGG + Intronic
1100659652 12:96682958-96682980 CAAGGGAAAGACAAGGAAAATGG - Intronic
1100931139 12:99610583-99610605 AATGGGAAGCAGGAGAAAGAAGG + Intronic
1100979570 12:100153915-100153937 AAAGGGAAAGGGGAGGAAGATGG - Intergenic
1101212752 12:102551051-102551073 GAAGGGAAAGAAGAGGGAGAGGG - Intergenic
1101320284 12:103667526-103667548 CCAGGGAAAGAGAAGGAAGAGGG + Intronic
1101425751 12:104586711-104586733 CCAGGGAAACTGCAGGGAGAGGG + Intronic
1101677973 12:106937066-106937088 GAAGGGGAAGAGGAAGAAGAGGG - Intergenic
1101843065 12:108341819-108341841 GAAGAGGAAGAGGAGGAAGAGGG + Intergenic
1101931235 12:109015814-109015836 AAAGTGAAATGGGAGGAAGAGGG + Intronic
1102230392 12:111257711-111257733 GAAGAGGAAGAGGAGGAAGATGG - Intronic
1102270944 12:111534711-111534733 CAAGGGAAAGTGGAGTAAGTAGG + Intronic
1102394197 12:112574036-112574058 AAAGGGGAGGAGGAGGAAGAGGG + Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102564681 12:113788116-113788138 AAAGAGAAAGAGGAGAAAGAAGG + Intergenic
1104181639 12:126387116-126387138 TGCAGGAAACAGGAGGAAGATGG - Intergenic
1104616365 12:130273330-130273352 TAAGGGGAGGAGGAGGAAGAGGG - Intergenic
1104783826 12:131437396-131437418 CCAGGGAAAGATGGGGAAGAGGG + Intergenic
1105037316 12:132935175-132935197 CAAGGGACACAGGAAAAAGGAGG + Intronic
1105219090 13:18309012-18309034 TGAAGGAAACATGAGGAAGAGGG - Intergenic
1105634124 13:22201058-22201080 CAAGTAAAACAGGAGGATTATGG + Intergenic
1105648263 13:22344766-22344788 GAAGGAAAACAGGAGGGACAAGG + Intergenic
1105826210 13:24125773-24125795 AAAAGGAACCAGGAGGCAGAAGG + Intronic
1106175984 13:27332090-27332112 CACAGGAATGAGGAGGAAGAGGG + Intergenic
1106196405 13:27497894-27497916 CAAGGGAAGCAAGGGGTAGAAGG - Intergenic
1106459869 13:29959350-29959372 CCTGGAAAACAGTAGGAAGAAGG + Intergenic
1106584676 13:31046670-31046692 GAAGTGACACAGTAGGAAGACGG + Intergenic
1106722535 13:32450818-32450840 GAAGGGAAACAAGGGAAAGAAGG - Intronic
1106856597 13:33860309-33860331 CAAGGGAAGGAGGAGGATGGAGG + Intronic
1107149101 13:37091287-37091309 CATGGGAAAAAGGAAGAAGAGGG + Intergenic
1107229568 13:38091830-38091852 AAAGGGAAAACAGAGGAAGAAGG + Intergenic
1107302318 13:38978474-38978496 GAAGGGAATAAGGAGGAACAAGG - Intronic
1107615708 13:42164990-42165012 GAAGGGGAAAAGGAAGAAGAAGG - Intronic
1108144216 13:47459813-47459835 CAACTGAAACTGGAGAAAGAGGG + Intergenic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1109147692 13:58801808-58801830 GAAGGGAAAAGGAAGGAAGAAGG + Intergenic
1110182652 13:72635889-72635911 CAAGGGAAGCAAGAGAGAGAAGG - Intergenic
1110336166 13:74333318-74333340 TATGGGAGACAGGAGGAAGTAGG - Intergenic
1110533085 13:76618969-76618991 CAAGGGAAACAGGAACAATGTGG + Intergenic
1110700560 13:78542842-78542864 AAAGGGAAAAAGAAGGAAAAAGG + Intergenic
1110809284 13:79793474-79793496 CCAGGTAAACAGGAAGGAGAAGG + Intergenic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1111083044 13:83337373-83337395 CAAGGTAAAGAAGAAGAAGAAGG + Intergenic
1111111156 13:83711460-83711482 CAAGGGAAAAAGAGAGAAGAAGG + Intergenic
1111396354 13:87672948-87672970 GAAGGGAAAACGGAGGAAGAAGG - Intronic
1111800989 13:92980641-92980663 CAAGGCAAACATGAATAAGATGG + Intergenic
1111961205 13:94812536-94812558 CAAGAGAAAGAGGAGGAGGGAGG - Intergenic
1112092567 13:96097161-96097183 CAAGGTAACCATCAGGAAGAAGG - Intronic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1112567959 13:100567424-100567446 CAATGGAATAATGAGGAAGATGG - Intronic
1112630895 13:101160299-101160321 AAAGCGAAAAAGAAGGAAGAGGG - Intronic
1112714298 13:102165866-102165888 AAAGGGAAACAGGAGGAATGAGG + Intronic
1112765481 13:102737519-102737541 CAAGGGAAAGAGGACGGAGAAGG - Exonic
1112765543 13:102738068-102738090 CAAGGGAAAGAGGACAGAGAAGG - Exonic
1113129822 13:107023484-107023506 CAAGGGCAAGAGGAGGATGAAGG - Intergenic
1113280160 13:108779780-108779802 GGAGGGACACAGCAGGAAGAAGG - Intronic
1113587583 13:111475845-111475867 CTAGAGATACAGGAGCAAGATGG - Intergenic
1113698754 13:112366966-112366988 CAAGGGAGGCAGCAGGAAGTGGG + Intergenic
1113876170 13:113596225-113596247 GCAGGGAAGCAGGATGAAGAGGG + Intronic
1114151368 14:20043477-20043499 CAAGTGAAAGAGGAGGCAAATGG - Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114359890 14:21959747-21959769 GAAGGGAAAAGGGAGAAAGAGGG - Intergenic
1114404114 14:22438958-22438980 AAAGGGAAAAAGGAAGAAGAGGG + Intergenic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114530966 14:23396264-23396286 CAGGTGAGACAGGAGGAAAAGGG - Exonic
1115248404 14:31320227-31320249 CATGGCGAACAGGATGAAGAAGG + Intronic
1115620117 14:35132830-35132852 CAAAGGAAAGGGAAGGAAGAAGG + Intronic
1115752562 14:36506385-36506407 CAAGGGAACCTGGGGGCAGAGGG - Intronic
1115892538 14:38047422-38047444 CAGAGGAAACAGGAAGAAGTTGG - Intergenic
1115933893 14:38529772-38529794 TACTGGAAACATGAGGAAGAGGG + Intergenic
1116288287 14:43001431-43001453 CAATTGAGACAGAAGGAAGAAGG + Intergenic
1116475137 14:45331204-45331226 GAAGGAGAAGAGGAGGAAGAAGG - Intergenic
1116658972 14:47683309-47683331 TAAGGGAGACAGGAAGAAGAGGG - Intergenic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117483352 14:56170362-56170384 TAAGGGAAACCAGAGCAAGAAGG - Intronic
1118227839 14:63919600-63919622 CAAGTGGAAGAGGAGGAACAAGG + Intronic
1118428039 14:65688872-65688894 GAAGGTAAACACCAGGAAGAAGG - Intronic
1118436869 14:65779573-65779595 CAAGGAAAAAAGAAGGCAGAAGG + Intergenic
1118459543 14:65976004-65976026 GAAGGGAAGCAGGAGAAGGAGGG + Intronic
1118635734 14:67747426-67747448 GAAGGGAAGCAGGAGGGAAAAGG + Exonic
1118770092 14:68937049-68937071 CAAGGGAAAAAGGAAGGAGGAGG - Intronic
1118995423 14:70831315-70831337 AAAGGAGAGCAGGAGGAAGAAGG - Intergenic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119328860 14:73779015-73779037 AAAGGAAGACAGGAGGAAGGAGG + Intronic
1119709958 14:76814417-76814439 AAAGGCTAATAGGAGGAAGAAGG + Intronic
1120016053 14:79474823-79474845 AGAGGGAAAGAGGAGGAGGAAGG + Intronic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1121006773 14:90495730-90495752 CAAGGAAAACAGTGGGATGATGG + Intergenic
1121598135 14:95181519-95181541 CAAGGGCAGCAGGAGTAAGATGG - Intergenic
1121703048 14:95970642-95970664 CAAGGCAAACAGAATGGAGAAGG + Intergenic
1121726179 14:96152125-96152147 CAAAGGAAATAGAAGAAAGAAGG + Intergenic
1124109107 15:26771594-26771616 CCAGGGAATCAGGAGAAGGATGG - Intronic
1124121640 15:26893682-26893704 CAGGGGAAACAGGAGGATCTGGG + Intronic
1124490271 15:30151093-30151115 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1124647668 15:31450426-31450448 GAAGGGAAAGGGAAGGAAGACGG + Intergenic
1124753262 15:32387236-32387258 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1124889072 15:33715011-33715033 CAAGGGATGCATGAGGAAGAAGG + Intronic
1124955017 15:34354619-34354641 GATGGAAAACAAGAGGAAGAAGG + Exonic
1124971975 15:34496588-34496610 GAAAGGAAAGAGGAGGAAGACGG - Intergenic
1124975002 15:34522936-34522958 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1125031441 15:35079620-35079642 CAAGAGAAAAAGGAGGAGAAAGG + Intergenic
1125476319 15:40050349-40050371 CAAGGGAGAGAGGAGTAACAAGG + Intergenic
1125536527 15:40443707-40443729 CAAAGGAAGCAGGAGGGAAAGGG - Intronic
1125547284 15:40515320-40515342 AAAGAAAAAGAGGAGGAAGAGGG - Intergenic
1126373570 15:47972068-47972090 CAAGAGACAGAGGAGGAAGAAGG - Intergenic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1126698959 15:51350689-51350711 CAAGGAAGACAGGAGGGAGCTGG + Intronic
1126857457 15:52852890-52852912 CAAGGGAAACAGGACAGAAATGG + Intergenic
1127178726 15:56391340-56391362 GAAGGGCAACTGGAGGAAGAAGG + Exonic
1127205742 15:56716389-56716411 CTAGGCAAACAGGAGAAGGAAGG + Intronic
1127343118 15:58066605-58066627 GAGGGGAAACAGCCGGAAGAGGG - Intronic
1128324665 15:66716590-66716612 AAAGGGAAACAAAAAGAAGAGGG - Intronic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1129210437 15:74064983-74065005 GAAGGAAAAGGGGAGGAAGATGG - Intergenic
1129403578 15:75300390-75300412 GAAGGAAAAGGGGAGGAAGATGG + Intergenic
1129658824 15:77541903-77541925 GAAGGGAAGGAGGAGGAAGGAGG - Intergenic
1129695677 15:77739496-77739518 CAAGGGAAAAAGGAGGGGAAAGG - Intronic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1129727630 15:77909614-77909636 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1129840257 15:78739356-78739378 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1129983997 15:79900322-79900344 GAAGGGAAAGAGGAAGAAGAGGG - Intronic
1130135165 15:81176386-81176408 AATGGGAAACGGGAGGAAGTCGG + Intronic
1130258647 15:82337640-82337662 GAAGAGAAAGGGGAGGAAGATGG - Intergenic
1130270038 15:82441444-82441466 GAAGAGAAAGGGGAGGAAGATGG + Intergenic
1130275938 15:82476398-82476420 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130282661 15:82531876-82531898 GAAGGGAAAGGGGAGGAGGATGG + Intergenic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1130462374 15:84168757-84168779 GAAGGGAAAGGGGAGGGAGATGG + Intergenic
1130468299 15:84203790-84203812 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130485450 15:84395964-84395986 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1130490299 15:84426028-84426050 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130495967 15:84469752-84469774 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1130501890 15:84504786-84504808 GAAGGGAAAGGGGAGGGAGATGG - Intergenic
1130590592 15:85208388-85208410 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130596275 15:85252320-85252342 GAAGGGAAAGGGGAGGGAGATGG + Intergenic
1130608365 15:85337948-85337970 CAATGGAAAAAGGAGGGAGCGGG - Intergenic
1131337906 15:91567652-91567674 GAAGAGGAACAGGAGGAAGAAGG - Intergenic
1131531581 15:93197608-93197630 AAAAGGAAAAAGAAGGAAGATGG - Intergenic
1131989484 15:98079722-98079744 AAAGGGAAGCATGGGGAAGAAGG - Intergenic
1131990263 15:98086383-98086405 GAAGAGGAAGAGGAGGAAGAAGG + Intergenic
1132123443 15:99197962-99197984 CCAGGAAAACAAGAGGAAAAGGG - Intronic
1132185335 15:99798342-99798364 GAAAGGAAAGGGGAGGAAGAAGG + Intergenic
1132282859 15:100635135-100635157 AAAGGGAAACAGGAGTGACAAGG - Intronic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1133485293 16:6214190-6214212 GAAGGGAAACATGAGAGAGATGG - Intronic
1133589596 16:7229725-7229747 CAAGGGAGGGAGGGGGAAGAAGG + Intronic
1133677551 16:8089236-8089258 AAAGGGAAATAGGAGATAGAAGG + Intergenic
1133740171 16:8645264-8645286 TAAGGAAAAAGGGAGGAAGAGGG + Intronic
1133836914 16:9375732-9375754 GTAGGGAAAGAGGAGGAATAGGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134186310 16:12087825-12087847 CACGTCAACCAGGAGGAAGAGGG - Exonic
1134330811 16:13249695-13249717 CAAGTGAAGGAGAAGGAAGAGGG - Intergenic
1135112100 16:19698337-19698359 AACAGGAAAGAGGAGGAAGAAGG - Intronic
1135563445 16:23494114-23494136 GACGAGAAACAGGAGGAAGAAGG + Intronic
1135692694 16:24555852-24555874 CAACGGAAACACGTGTAAGATGG - Exonic
1135913868 16:26586032-26586054 CATGGGAAGCAAGGGGAAGAGGG - Intergenic
1136054440 16:27677915-27677937 CACGGGGAACAGGAGACAGAAGG + Exonic
1136153416 16:28366585-28366607 CAAGGGTGACAGGAGGGAAACGG + Intergenic
1136209670 16:28748682-28748704 CAAGGGTGACAGGAGGGAAACGG - Intergenic
1136513820 16:30756052-30756074 GAAGGCAGACAGAAGGAAGATGG + Intronic
1137413031 16:48245180-48245202 AAAGGGAAACAGAAGGATTAGGG - Intronic
1138124437 16:54427152-54427174 GAAGGGGCACAGGAGGAAGTGGG + Intergenic
1138224730 16:55282850-55282872 AATGGGAGAGAGGAGGAAGAAGG + Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1138272153 16:55703043-55703065 TATGGGGGACAGGAGGAAGAGGG + Intronic
1138586379 16:57972902-57972924 GAAGGGAAAGGGGAGGAAAAAGG + Intergenic
1138587735 16:57982066-57982088 CAACTGAAGCAGGAGGAAGGTGG - Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138849039 16:60604785-60604807 CATGGCAGGCAGGAGGAAGAGGG + Intergenic
1138852390 16:60644471-60644493 GAAGGGACACAGGATGAAGGAGG - Intergenic
1138860110 16:60745297-60745319 CAAGAGAAAAATGAGGAAGAAGG + Intergenic
1139910075 16:70392231-70392253 CAAGGGAAAGGGAAGGAACATGG + Intronic
1140332549 16:74072031-74072053 GAAGAGAAATAGGAAGAAGAAGG + Intergenic
1140487464 16:75305015-75305037 CGAGGGAAAGAGGGGTAAGAAGG - Exonic
1140798454 16:78462877-78462899 CAAGGGAAACAGTAAGGACAGGG - Intronic
1141286861 16:82680810-82680832 CAATGGAACCAGGAGATAGAAGG + Intronic
1141319718 16:82996016-82996038 CAAGGGAGAAAACAGGAAGATGG - Intronic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1142137826 16:88459731-88459753 GAAGGGGAGGAGGAGGAAGAGGG - Intronic
1142255075 16:89009820-89009842 CAAGGGAGAGAGGAGGCAGGTGG + Intergenic
1142368442 16:89663695-89663717 GAAGGGCAGCAGGAGGAAGATGG + Intronic
1142891538 17:2947229-2947251 GAAGGGAAAGAGGAGCAAGCAGG + Intronic
1143391521 17:6561626-6561648 GAAGAGGAAGAGGAGGAAGAGGG - Intergenic
1143455353 17:7064191-7064213 CAAGAAAAACAGGGCGAAGAGGG + Intergenic
1143514469 17:7412966-7412988 AAAGGGAAGGAGCAGGAAGAGGG - Intronic
1144214468 17:13043160-13043182 CAAGAGAAAGAGGAGGGAGAGGG + Intergenic
1144305213 17:13963750-13963772 CAAGGGAAAGGGGAGGATGAAGG - Intergenic
1144748781 17:17633920-17633942 GAAGGGAAGATGGAGGAAGAGGG - Intergenic
1145253557 17:21310411-21310433 GAAGGAAAACAGCAGGAACAAGG - Intronic
1145837198 17:27963550-27963572 GAAGGGCAAGAGGAGGAAGGAGG + Intergenic
1145983410 17:29027838-29027860 CAAGGGAAGGAGGGGGAAAATGG - Intronic
1145994362 17:29097007-29097029 CCAGGGATGCAGGAGGAAGTCGG + Intronic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1146697228 17:34918965-34918987 CAAGAGAAAAACGAGGAAGAAGG - Intergenic
1146697525 17:34920899-34920921 CAAGAGAAAAATGAGGAAGAAGG - Intergenic
1147053979 17:37819716-37819738 CAACAGAAGAAGGAGGAAGAGGG - Intergenic
1147250420 17:39149903-39149925 CAAGGTAAACAGGAGAGAGTTGG - Intronic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147397772 17:40158135-40158157 GCAGGGAAAAATGAGGAAGAGGG + Intronic
1147677616 17:42218893-42218915 CAAGGCCAACAGGAGGACAATGG + Intronic
1147688423 17:42300678-42300700 CAAGGCCAACAGGAGGACAATGG - Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148029376 17:44608985-44609007 CAAAGGGAGCAAGAGGAAGAAGG + Intergenic
1148113663 17:45162146-45162168 AAAGGGAAACAGGAGAAAAGGGG - Intronic
1148326075 17:46784188-46784210 CATGAGAAACAGGAGGAAGGAGG + Intronic
1148532917 17:48412054-48412076 TAAGGGAAACTGGAGGAGAAAGG + Intronic
1148858244 17:50590817-50590839 CAAGGTCAACAGGAGCAAGGTGG - Intronic
1149524292 17:57341906-57341928 AAAGAGAACAAGGAGGAAGAAGG - Intronic
1149626199 17:58082817-58082839 CAAAGAACAAAGGAGGAAGAAGG + Intergenic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150791847 17:68205625-68205647 GAAGGGAAAGCGGAGGAGGAGGG - Intergenic
1151162970 17:72181386-72181408 CAAGGTAAACGGGAAGAGGATGG - Intergenic
1151234931 17:72713086-72713108 GAAGGTAAACAGGAAGAAGCAGG + Intronic
1151345799 17:73500499-73500521 GAAGGAGAACAGAAGGAAGATGG - Intronic
1151757683 17:76083912-76083934 CAAGGGAAAAAGGAGAAGGGTGG - Intronic
1152204886 17:78969332-78969354 CAATGAGATCAGGAGGAAGAAGG - Intergenic
1152353569 17:79796318-79796340 AAAGGGAATCAGGAAGAAGTGGG + Intronic
1152537555 17:80959525-80959547 CCAGGGACGCAGGAGGAAAAGGG - Intronic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152696539 17:81800505-81800527 GAAGGGAAACAGGAGGGTGGTGG - Intergenic
1153162759 18:2227490-2227512 CCAGGGAAACAGGGTGAAGTCGG + Intergenic
1153267339 18:3284201-3284223 CAAGTGAAACAGAAGACAGATGG + Intergenic
1153449672 18:5213248-5213270 CAAGCGAAAAAGGAGTAAAAAGG + Intergenic
1153612302 18:6898879-6898901 CAGGGGCAAAAGGGGGAAGAGGG + Intronic
1153764750 18:8364991-8365013 TAATGGAAAAAGGAGGATGATGG + Intronic
1155495687 18:26439620-26439642 CAAGAAAAAGAGGAGGAAGCTGG - Intergenic
1156035385 18:32760879-32760901 CAAGGGCATCAGAAGGAAGTGGG - Intronic
1156374536 18:36501466-36501488 CAAGGGAGGCATGAGGTAGAAGG + Intronic
1156486028 18:37466250-37466272 GAAGTGGAAGAGGAGGAAGAAGG + Intronic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1156961298 18:43034908-43034930 CAAGGCACAGAGGAGGAGGAAGG - Intronic
1157496028 18:48158177-48158199 AAAGAGAAAAAGGAGGAACAGGG - Intronic
1158440108 18:57467911-57467933 AAAAGGAGACAGGAGGGAGAAGG - Intronic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158883574 18:61804650-61804672 CAAGAGAAAAAGGAGGCATAGGG - Intergenic
1159553863 18:69924663-69924685 AAAGGGCAACAGTAGGATGAAGG + Intronic
1160448617 18:78946949-78946971 AAAGGGAGAGAGGAGGAAAAGGG + Intergenic
1160556728 18:79730371-79730393 CCAGGAAACCAGGAGGGAGACGG - Intronic
1160701430 19:509239-509261 AACGGGGAGCAGGAGGAAGATGG + Intronic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1161866039 19:6832747-6832769 AAAGTGGAAGAGGAGGAAGAGGG - Intronic
1162105375 19:8366837-8366859 CAAGAGAGGAAGGAGGAAGAGGG - Intronic
1162734822 19:12740812-12740834 GGAGGGAAACAGGAGGAATTGGG + Intronic
1162818813 19:13210780-13210802 CAAGAGAAATCGGAGGGAGAAGG + Intronic
1162838145 19:13335222-13335244 GAAGGGAAACAGGAAGAGGTGGG - Intronic
1163200933 19:15768583-15768605 AAAGGGAGAAAGAAGGAAGAGGG - Intergenic
1163382489 19:16978205-16978227 CATGGGCAACAGGAGGAAGTGGG + Intronic
1163779667 19:19239757-19239779 CAAGGGGAAGAGGAAGGAGAAGG - Intronic
1164701233 19:30286063-30286085 GGAGGGAGAGAGGAGGAAGAGGG - Intronic
1164720014 19:30425086-30425108 CAAGGGAAAGAGTAGGAAAGGGG + Intronic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1164856324 19:31527460-31527482 GAAGGGAAACAGAAGGGTGAGGG + Intergenic
1164858223 19:31541920-31541942 CATGGAAAAGAGGAGGCAGAAGG + Intergenic
1165137660 19:33680061-33680083 AAAGGGAAAAGGGAGGAAGCTGG - Intronic
1165601562 19:37058926-37058948 CAAGGGAGAAGGGAGGCAGAGGG + Intronic
1166326857 19:42056394-42056416 CACAGGAAGCAGGGGGAAGAGGG + Intronic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1167051981 19:47084992-47085014 AAAGGGAAAAAGGACTAAGAAGG + Intronic
1167556422 19:50199026-50199048 CTAGAGCAAAAGGAGGAAGAGGG - Intronic
1167665446 19:50820780-50820802 CCAGGGAAGAGGGAGGAAGAGGG + Intronic
1167698388 19:51027891-51027913 GAAGGGAAACTGGAGGAGGGAGG - Intronic
1167783877 19:51620303-51620325 CAGAAGAAACAGGAGGAAAAAGG + Intronic
1167804551 19:51771688-51771710 TAGGGGAAACAGGAGGGAAAGGG - Intronic
1167975016 19:53218953-53218975 TAAGGGAAACAGGAGTATGCTGG - Intergenic
1168025557 19:53641094-53641116 CAGAGGAAACAGGAGGGAAAAGG + Intergenic
1168182354 19:54670975-54670997 CCATGGAAAGAGGAGGAGGAAGG + Intronic
1168578168 19:57531056-57531078 CATGGGAATCTGTAGGAAGAGGG - Exonic
925402895 2:3588338-3588360 CCAGGGATCCAGGAGGAAGCGGG - Intergenic
925683205 2:6444819-6444841 GAAGAGACACAGGAAGAAGATGG - Intergenic
925746315 2:7046652-7046674 CAAGGAAAACAGGAGGGAAGAGG - Intronic
926707051 2:15844305-15844327 CCATGGAAACAGGAGAAGGAAGG - Intergenic
927140891 2:20130101-20130123 CAAGTGAGACAGGAGGAAGAGGG - Intergenic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
927953854 2:27193869-27193891 GAAGGGAGACAGGGGTAAGAGGG - Intergenic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929055906 2:37875706-37875728 TAAGGGAAAGAGGAGGGAGGGGG + Intergenic
929162045 2:38841689-38841711 CTACGGAAAAAGGAGCAAGAAGG + Intronic
929373388 2:41254238-41254260 CAAGGGAGACACAAAGAAGAAGG + Intergenic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
929444474 2:41991889-41991911 CAAGGGGGAAAGGAGGGAGAAGG + Intergenic
929766490 2:44848181-44848203 AATGGGGAACAGGAGGAAGCTGG - Intergenic
929940989 2:46333867-46333889 CAAGGGAAACAAACAGAAGATGG + Intronic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930219747 2:48734558-48734580 GAAGGGAGAGAGGAGGAAGGAGG - Intronic
930227223 2:48806109-48806131 CAAGAGAAAAAGGAGGAATAAGG + Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
931000173 2:57770874-57770896 AAAGGGAAGAAGGAGAAAGAAGG - Intergenic
931845858 2:66203290-66203312 CCAGGGAAACAGGGGCCAGAGGG + Intergenic
931926006 2:67073390-67073412 CAAGAGAACCAGGAGAAAGTAGG - Intergenic
931992797 2:67807892-67807914 CAAGTGGAGGAGGAGGAAGAAGG - Intergenic
932080136 2:68706785-68706807 AAAGAGAAAGATGAGGAAGAAGG - Intronic
932796393 2:74699659-74699681 CAAGGGTAGGTGGAGGAAGATGG + Intergenic
933178921 2:79208064-79208086 TATGGGAATCAGGAGGGAGAAGG - Intronic
933800248 2:85954694-85954716 CAAGGCAAAATGGAGGAACAGGG + Intergenic
934295235 2:91737624-91737646 TGAAGGAAACATGAGGAAGAGGG + Intergenic
934578671 2:95420405-95420427 AATGGGAGACTGGAGGAAGATGG - Intergenic
934977175 2:98811111-98811133 CAAGGGAAACACGATGAATCTGG + Intronic
935327174 2:101947701-101947723 CCAGGGACACAAGAGAAAGAAGG - Intergenic
935403406 2:102683730-102683752 AAAGAGAAACAGGAGGATGGAGG - Intronic
935462527 2:103355016-103355038 GAAGGCAAACAGGGGGCAGAAGG - Intergenic
935566357 2:104612205-104612227 CACGGGAAAAGGCAGGAAGAGGG - Intergenic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936534146 2:113298442-113298464 AATGGGAGACTGGAGGAAGATGG + Intergenic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
937234653 2:120423402-120423424 CAATGGAAAGAGGAGGAGGGAGG - Intergenic
937241296 2:120464252-120464274 AAAGGGAAAGAGCAGGAAAAGGG + Intergenic
937251205 2:120524923-120524945 AAAGGGAAACAGCAGGTAGAGGG - Intergenic
937363703 2:121245973-121245995 AATGTGAAACAAGAGGAAGATGG + Intronic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
938131729 2:128721812-128721834 AAAGGGACACAGGAGGCAGCTGG + Intergenic
938173304 2:129102039-129102061 GCAGGAAAACAGGAGGCAGATGG - Intergenic
938542507 2:132296165-132296187 GAAGGGAAGAAGGAGGAAGAGGG - Intergenic
938594829 2:132777314-132777336 CAAGAGACACAGGGGGAAAAGGG + Intronic
938609283 2:132930466-132930488 AAAGGTAAAAAGGTGGAAGAAGG + Intronic
939731709 2:145792921-145792943 CCAGGGAAGTAGGGGGAAGATGG + Intergenic
939969368 2:148643258-148643280 GAAGAGGAACAGGAGGAAAAAGG + Intergenic
940185069 2:150975403-150975425 CAAGGGAAAAGGGTGGGAGAAGG - Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
940372309 2:152917045-152917067 CATGGCAAAAAGGAGGAACACGG - Intergenic
941067231 2:160917252-160917274 AAAGTGAAACAGGATAAAGAAGG + Intergenic
941194315 2:162428332-162428354 GAAGGGGAGAAGGAGGAAGAGGG - Intronic
941505276 2:166336434-166336456 CATGGGAACATGGAGGAAGAAGG + Intronic
941601326 2:167546925-167546947 CAAGGGAAAGTGAAGGATGAGGG - Intergenic
941615885 2:167718809-167718831 CAGGGGAGAAAGGAGGGAGAAGG + Intergenic
941770378 2:169338419-169338441 AAAAGAAAAAAGGAGGAAGACGG + Intronic
941772004 2:169355159-169355181 GAAGGAGAACAGGAGAAAGAAGG - Intronic
941989533 2:171541440-171541462 CAGGGGTAACATGGGGAAGAGGG + Intronic
942032585 2:171977761-171977783 AAAGGAATACAGAAGGAAGAAGG - Intronic
942222715 2:173787219-173787241 CAAGGGAGAAAGGTGGGAGAAGG - Intergenic
942322772 2:174750422-174750444 CATGGGACACAGGAAGAAGATGG + Intronic
942961742 2:181837619-181837641 CAATTGAAAGAGGAGGAAGGTGG - Intergenic
943063597 2:183063856-183063878 AAAGGGAAACAAAAGAAAGAAGG - Intergenic
943135876 2:183912532-183912554 AAAGAGAAGCAGGAGAAAGAAGG - Intergenic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944299955 2:198112367-198112389 CAAGAGAAACAAGAGGAGGCTGG - Intronic
944328280 2:198433210-198433232 GAAGTGAAGGAGGAGGAAGAGGG + Intronic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
945193565 2:207216118-207216140 AAAGGGAAGCAGGTGGTAGAAGG + Intergenic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
946152421 2:217785504-217785526 CCGGGGACACAGGAGGCAGAGGG - Intergenic
947264826 2:228266951-228266973 CAAGGGAAATATGAGTTAGAGGG + Intergenic
947390601 2:229635412-229635434 CAAGGGTACAAAGAGGAAGAGGG + Intronic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
947722131 2:232376643-232376665 CAAGGGCATCAGGTGGTAGAGGG - Intergenic
947972687 2:234337290-234337312 CGAGGGACAAAGGAGGAAGGAGG + Intergenic
948172997 2:235920661-235920683 TAAAGCAAACAGGAGGCAGATGG + Intronic
948228106 2:236328654-236328676 CAAGGCTAAAAGAAGGAAGAGGG - Intronic
948290732 2:236822396-236822418 AGAAGGAAAGAGGAGGAAGAAGG + Intergenic
948603471 2:239120573-239120595 CAAGGGGAGAAGGAGGAAGGTGG + Intronic
948691881 2:239711415-239711437 CCAGGGACAAAGGAGGAGGAGGG - Intergenic
948946635 2:241223871-241223893 AAAGGGCAGCAAGAGGAAGAGGG - Intronic
1168874411 20:1160917-1160939 CAAGGCCAACAGAAAGAAGATGG + Intronic
1169015421 20:2289026-2289048 CATGGGTAAAAGGAGGAAGTTGG + Intergenic
1169027537 20:2383329-2383351 CAAGGGCAGGAGGAGGAAGATGG + Intronic
1169048600 20:2558214-2558236 CAAGGGAGACGGGAGGGAGAAGG + Intronic
1169266620 20:4171021-4171043 CCATGGAAGCAGGAGCAAGAAGG + Intronic
1169449128 20:5696400-5696422 CAAGGGAAACATGAGGACAGTGG + Intergenic
1169958453 20:11131911-11131933 CAAAGGAAAGAGGAGGAAACAGG - Intergenic
1170012165 20:11736084-11736106 CTTGGGAAGCAGGTGGAAGAGGG - Intergenic
1170110060 20:12795427-12795449 CATGGGAAAAAGGAGAAGGAGGG - Intergenic
1170301701 20:14891048-14891070 GAAGGGGAAGAGGAAGAAGAAGG - Intronic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1170717874 20:18847628-18847650 GAAAGGAAAAAGGAGGAAGCAGG + Intergenic
1170948919 20:20916630-20916652 GAAAGGAAAAAGGAGGAGGATGG + Intergenic
1171152880 20:22843192-22843214 TCAAGGAAACAGAAGGAAGAGGG + Intergenic
1171163611 20:22951391-22951413 CAAGGCAAAGAGGAAGAAGATGG + Intergenic
1171181894 20:23097115-23097137 CACGGGAAACAGGAAGGTGAGGG - Intergenic
1171871387 20:30529012-30529034 GAAGGGAAGAGGGAGGAAGAGGG - Intergenic
1172133750 20:32673484-32673506 CAAGGGACACATGAGGCACAGGG + Intergenic
1172157005 20:32834024-32834046 CAAGGGGAATAGGGGCAAGAAGG - Intronic
1172846475 20:37932447-37932469 CAAGGCAAGCAGGAGGAGCAGGG + Intronic
1173253224 20:41375461-41375483 CCAGAGAAACAGGAGGAGGATGG - Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173898589 20:46569809-46569831 GTAAGAAAACAGGAGGAAGAGGG - Intronic
1173905593 20:46626349-46626371 CCAGAGAGACAGGAGAAAGAGGG - Intronic
1174055723 20:47796936-47796958 AAAGGGAAAAAGGAGGTAGGTGG - Intergenic
1174092066 20:48057411-48057433 TAAGGGAAGCCGGAGGAAGTGGG - Intergenic
1174108661 20:48182183-48182205 AAAGGGTAAAAGGAGGAAAAAGG + Intergenic
1174256226 20:49257634-49257656 GAAGGGGATGAGGAGGAAGAAGG - Exonic
1174277516 20:49414617-49414639 CAAGGGAAACAGGCGCCAGAGGG - Intronic
1174282958 20:49452608-49452630 GAAGGGAAAAGGCAGGAAGATGG + Intronic
1174308397 20:49631557-49631579 GAAGCGATACAAGAGGAAGAGGG - Intergenic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1174656693 20:52177611-52177633 CACCGAGAACAGGAGGAAGACGG + Intronic
1174959779 20:55142613-55142635 CAATAGAAACTGGAAGAAGAAGG + Intergenic
1175045586 20:56101911-56101933 GAAGGAAAACAGGAGGGGGAAGG + Intergenic
1175120085 20:56710598-56710620 GAAGGGGAAGAGGGGGAAGAAGG - Intergenic
1175135218 20:56818375-56818397 GAAGGGAGGAAGGAGGAAGAGGG + Intergenic
1175203635 20:57294393-57294415 AAAAGGAAACAAGAAGAAGAAGG + Intergenic
1175496973 20:59422036-59422058 CAAGTGAAACAGGACCACGAGGG - Intergenic
1175904353 20:62372250-62372272 CAGGGGAAACAGGCGGAATGGGG + Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1177259193 21:18706945-18706967 AAAGGGGAAAAGGGGGAAGAGGG - Intergenic
1177423256 21:20889823-20889845 CAAGGCAGAGAAGAGGAAGAAGG - Intergenic
1177874582 21:26615586-26615608 GAAGGGAGGAAGGAGGAAGAAGG + Intergenic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178241976 21:30913098-30913120 GAAGGGAAAGGGGAGAAAGAGGG + Intergenic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1178434480 21:32545909-32545931 CTAGGGAAAGGGAAGGAAGAAGG - Intergenic
1178459680 21:32791495-32791517 AAGGGGAAAAAGGAGGAAAAAGG - Exonic
1178894548 21:36548135-36548157 CAAGGAAAAGAGGAGACAGAGGG - Intronic
1179956738 21:44744999-44745021 CAAGGGAAATAGGACGAACATGG + Intergenic
1180789223 22:18565355-18565377 CAAGGTCTACAGGAGAAAGAAGG + Intergenic
1180816685 22:18793868-18793890 TGAAGGAAACATGAGGAAGAGGG - Intergenic
1181202876 22:21228215-21228237 TGAAGGAAACATGAGGAAGAGGG - Intergenic
1181232518 22:21429956-21429978 CAAGGTCTACAGGAGAAAGAAGG - Intronic
1181246133 22:21504901-21504923 CAAGGTCTACAGGAGAAAGAAGG + Intergenic
1181787446 22:25237429-25237451 GAAGGGCGGCAGGAGGAAGATGG - Intergenic
1181906921 22:26205425-26205447 TAAGGTAAACCTGAGGAAGAAGG - Intronic
1182196478 22:28523957-28523979 AAAGGGAGAAAGGAGGAAAAGGG - Intronic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183261360 22:36797871-36797893 CGTGGGAGGCAGGAGGAAGAGGG + Intergenic
1183284490 22:36953534-36953556 CAAGGGGAGCAGGAGGAGGGTGG + Intergenic
1183305139 22:37078915-37078937 AAAGAGAAAGAAGAGGAAGAAGG + Intronic
1183393662 22:37560190-37560212 CGAGGGGAACCGGTGGAAGAGGG + Intergenic
1183539754 22:38423184-38423206 AAAGGGGAACAGGTGGGAGAGGG + Intergenic
1183646023 22:39127234-39127256 GAAGGGTCAGAGGAGGAAGAAGG - Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1183759448 22:39802653-39802675 AAAGGGAAACAGGAGAAAGAAGG + Intronic
1183866487 22:40708337-40708359 GAAGAGGAAGAGGAGGAAGAAGG + Intergenic
1184456679 22:44614868-44614890 GAAGGGGAGGAGGAGGAAGAGGG - Intergenic
1184563933 22:45279968-45279990 GAGGGGAAACAGGAGAAAAAGGG - Intergenic
1184819652 22:46900035-46900057 GAAGGAGAAAAGGAGGAAGAAGG - Intronic
1185157882 22:49205183-49205205 CATGTGAAAGGGGAGGAAGATGG + Intergenic
1185180351 22:49356690-49356712 GCATGGAAACAGGAGGAAGATGG - Intergenic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
1185392672 22:50571086-50571108 CCAGGCAGACAGGAGGCAGAGGG + Intronic
1203224043 22_KI270731v1_random:67211-67233 TGAAGGAAACATGAGGAAGAGGG + Intergenic
1203266784 22_KI270734v1_random:19589-19611 TGAAGGAAACATGAGGAAGAGGG - Intergenic
949519105 3:4833624-4833646 AGAGGGAAACAGAAGGAAGCAGG - Intronic
949545653 3:5069977-5069999 GTAGGGGAACAGGAGGGAGATGG + Intergenic
949920582 3:8997014-8997036 GAAAGAAAACAGGAGGAACAGGG + Intronic
949976976 3:9469981-9470003 GAAGGGAAAAAGGTGGAGGAAGG - Intronic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
950882606 3:16335362-16335384 CATGGGAAACAGGCTTAAGAAGG + Intronic
951157194 3:19370075-19370097 CAAGGCAAAGAGGAAGAAGGTGG - Intronic
951776517 3:26316457-26316479 CAAGGGGGACAGGAAGTAGAAGG - Intergenic
953142043 3:40238145-40238167 GAAGGGAAGGAGAAGGAAGAAGG - Intronic
953228970 3:41046404-41046426 CTGGGGAAACTGGAGGAAGGGGG - Intergenic
953538645 3:43795049-43795071 ACAGGGAAACAGGAAGAAGCTGG - Intergenic
953722363 3:45367579-45367601 CAAGGCAAACAGGAGTGACACGG - Intergenic
953928073 3:46992417-46992439 CAAAGAAGAGAGGAGGAAGATGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954727202 3:52622725-52622747 AAAGGAAAACAGGATGTAGAAGG - Intronic
955625866 3:60918619-60918641 AAAGGAAACCAGGAGGAAGAAGG + Intronic
956295942 3:67713788-67713810 CAAGAGCAACAGGAGAGAGAGGG - Intergenic
956575523 3:70748549-70748571 GTGGGGAAACAAGAGGAAGAGGG - Intergenic
956773839 3:72549089-72549111 GAAGGGAAACAGTGGGAAGGAGG - Intergenic
956856376 3:73279035-73279057 CAAAGGAAACAGGATGAGAATGG - Intergenic
957150485 3:76480021-76480043 AAATAGAAAAAGGAGGAAGAAGG + Intronic
957220168 3:77372137-77372159 AAAGGGAAAGAGAAGGAAGGAGG + Intronic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957843694 3:85703171-85703193 CAAGTGAAAAGGCAGGAAGAAGG + Intronic
958057965 3:88438352-88438374 AAAGGTAAACAGGAGAAAGAAGG - Intergenic
958077599 3:88702944-88702966 GAAAGGAAAAAGTAGGAAGAAGG - Intergenic
958415387 3:93867691-93867713 AAAGTGAGGCAGGAGGAAGAGGG - Intergenic
958963036 3:100528504-100528526 CAAGGGACAGAGGAGGAGGCAGG + Intronic
959049619 3:101512653-101512675 TGAGGGAAAGAGGAGGGAGAGGG + Intronic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
959911853 3:111772407-111772429 GAAGGAAAAGAAGAGGAAGAAGG + Intronic
960394302 3:117117499-117117521 CAAGAGAATGAGGAAGAAGAAGG + Intronic
960762178 3:121084401-121084423 CAATGAAAACACGTGGAAGAAGG - Intronic
960799660 3:121525418-121525440 CAAGGTAAAGATGATGAAGATGG - Intronic
961185534 3:124911960-124911982 GAAGGCAAACTGGAGGCAGATGG + Intronic
962204808 3:133425892-133425914 CAAGGGAAATAAGAGAAAGGAGG + Intronic
962241439 3:133754267-133754289 CCAGGCAAACAGGGGCAAGAAGG - Intronic
962360004 3:134731813-134731835 AAAGGGAAAAAGGGAGAAGAGGG + Intronic
962731823 3:138290426-138290448 CAAGGGGTACAGGAGGAGTAGGG + Intronic
963007794 3:140742023-140742045 CAAGAGAAACAGAAGCAATAGGG + Intergenic
963022972 3:140890317-140890339 AAAAAGAAACAGGAGTAAGAAGG + Intergenic
963163570 3:142177789-142177811 GAAGGGAGACAGGAGGTAGAAGG + Intronic
963909002 3:150799205-150799227 CCAGTAAAAAAGGAGGAAGACGG - Intergenic
964444597 3:156745446-156745468 GAAGGGAAAGAGGAGGAAGCAGG - Intergenic
964473515 3:157078222-157078244 TAAGGGATAAAGGTGGAAGAGGG - Intergenic
965023890 3:163273035-163273057 GAAGAGAAATAGGAGGAAGAAGG + Intergenic
965024071 3:163275847-163275869 GAATGGGGACAGGAGGAAGAAGG + Intergenic
965342391 3:167506147-167506169 GAAGGGAGGCAGAAGGAAGAGGG - Intronic
965524525 3:169702004-169702026 AAAGGAAAAGAGGAGGAAGAAGG - Intergenic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
965721686 3:171668937-171668959 CATGGGTAGCAGGAGGAAGTGGG - Intronic
965932342 3:174060344-174060366 ATAGGGAAAGAGGAAGAAGAAGG + Intronic
966002788 3:174971049-174971071 CAAGAGAAAAATGAGGAAGAAGG + Intronic
966396347 3:179507620-179507642 CAAGAACAACAGGATGAAGATGG - Intergenic
966585481 3:181619381-181619403 GAAGGGAAAAAGGTGGGAGAAGG + Intergenic
967856286 3:194119954-194119976 CAAGGGGAAGAGGAGGGAGATGG - Intergenic
967967892 3:194976391-194976413 CAAAGGAAACACCTGGAAGAGGG + Intergenic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968217294 3:196904222-196904244 ATAGGGTAGCAGGAGGAAGATGG + Intronic
968257306 3:197287622-197287644 AAAAGGAAAAAGGAGGAGGAAGG + Intronic
969312888 4:6364340-6364362 AAAGGGAGAGAGGAGGAAGTGGG + Intronic
969364224 4:6684761-6684783 CAAGGGAAGGAGGAGGCAGGGGG + Intergenic
969713509 4:8857802-8857824 CAAGGGCAAGGGGAGGAGGAGGG - Intronic
970126050 4:12812519-12812541 GAAGGGAAACAGGGGGAGAATGG + Intergenic
970563831 4:17311399-17311421 AAAGGGGAAAGGGAGGAAGAGGG + Intergenic
970709591 4:18846317-18846339 CAAGGGTAAGAGTAGGAAGATGG + Intergenic
971422801 4:26489489-26489511 AGAGAGAAACAGGAGCAAGACGG + Intronic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
971580826 4:28337437-28337459 GAAGGCAAACAGAAGGTAGAAGG + Intergenic
972103277 4:35448048-35448070 AGAAGGAAAAAGGAGGAAGAAGG + Intergenic
972359763 4:38316047-38316069 GAAGAGAAACAGGGAGAAGAGGG + Intergenic
972371549 4:38428774-38428796 CAAGAGAAAGAGGATGAAGAAGG + Intergenic
972491086 4:39587749-39587771 CAAAGAAGAAAGGAGGAAGAAGG + Intronic
973128403 4:46618250-46618272 AAAGTGAAAAAAGAGGAAGAAGG + Intergenic
973601778 4:52549434-52549456 CCAGGGAACCAGGAAGAGGATGG + Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974798984 4:66790703-66790725 GGAGGGAAACAAGAGGAAAAAGG - Intergenic
974803688 4:66852881-66852903 CAAGGAGAAAAGGAGAAAGAAGG + Intergenic
975069571 4:70117612-70117634 AAAGGGAGAGAAGAGGAAGAGGG - Intergenic
975542322 4:75526810-75526832 TAAGGAACACAGGAAGAAGATGG - Intronic
975545410 4:75555678-75555700 AAAGCGAAACAAGAGGGAGAGGG - Intergenic
975711531 4:77164865-77164887 CAAGGGAAATAGGAGAAAGATGG - Intronic
975971729 4:80047552-80047574 CAAGGGAGAGAGGGAGAAGAAGG - Intronic
976225574 4:82793385-82793407 GGAGGAAAACAGGAGGAAGATGG + Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977232082 4:94463616-94463638 GAAGGGAAGCAGGAGAAAGCAGG + Intronic
977254492 4:94725851-94725873 CAAGGGAGTCAGGGGGGAGAGGG - Intergenic
977845238 4:101759921-101759943 CAAGGGAACCTGGAGGTAAAAGG - Intronic
978016236 4:103749833-103749855 GAAGGAAAACAGGAGGAGCAGGG - Intergenic
978070339 4:104459760-104459782 TAAAGGAAAGAGAAGGAAGAGGG - Intergenic
978179982 4:105782195-105782217 AAAAGGAAAAAGGAGAAAGACGG + Intronic
978399511 4:108315738-108315760 CAAGAGAAACAAGAGGCAAATGG + Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978738318 4:112109394-112109416 CAAAGAAAATAGCAGGAAGATGG - Intergenic
978856968 4:113404401-113404423 CCAGGTAAACATGAGGAAGATGG + Intergenic
979280819 4:118865688-118865710 CTTTGGAAACAGGAGGAAGGAGG + Intronic
979320201 4:119314633-119314655 GAAGGGAAAAAGGAGGTAGATGG - Intergenic
979480863 4:121215606-121215628 AAAGAGAAACAGGAGAAAGATGG - Intronic
979508370 4:121524099-121524121 GAAGTGACACAGGATGAAGAAGG + Intergenic
979848776 4:125550661-125550683 AAATGGAAACAGGAGTAAAAAGG + Intergenic
979882948 4:125986012-125986034 CAAGGGCAAGAGGAGGAGGGTGG - Intergenic
980091454 4:128447476-128447498 GAAGGGGAACAGGAAGGAGAAGG - Intergenic
980104947 4:128578688-128578710 GACGGGAAAGACGAGGAAGAGGG + Intergenic
980223583 4:129951174-129951196 AAAGGAAAAAAGGAAGAAGAAGG + Intergenic
980998825 4:139808567-139808589 AAAGGCAAAAAGGAGGAAGCAGG + Intronic
982317736 4:154048309-154048331 CAAAGGATACAGGAGGAGGGTGG + Intergenic
982420040 4:155184005-155184027 AAGCGGAGACAGGAGGAAGAAGG - Intergenic
983653172 4:170053624-170053646 AAAGGGAGACTGGAAGAAGAAGG - Intergenic
983787762 4:171755479-171755501 CAAAATAAACAGGATGAAGAGGG + Intergenic
985063813 4:186103111-186103133 CAATGGTAACAAGAGGGAGAGGG - Intergenic
985071800 4:186172937-186172959 CAAGAGAAACAGTGGGGAGAGGG - Intergenic
985314674 4:188643940-188643962 GAGGGGAGACAGGAGGAACATGG - Intergenic
985385581 4:189444193-189444215 CAAGGCAAACAGGATGAAGAAGG - Intergenic
985560256 5:582163-582185 CAAGGGAACCAGGGGACAGAGGG - Intergenic
985573987 5:665300-665322 CAAGAGGAGCAGGAGGAAGGGGG + Intronic
985691299 5:1314237-1314259 CAAGGGAAATGGCAGGATGAGGG + Intergenic
985955435 5:3262167-3262189 ACAGGGCAACAGGAGGGAGAAGG - Intergenic
985988915 5:3539068-3539090 CAAGGAAGACAGGAAGAAGATGG + Intergenic
986069478 5:4268193-4268215 CCAGGGTCACAGGAGAAAGAGGG - Intergenic
986278649 5:6304497-6304519 GAAGGGAAAAAGATGGAAGAAGG + Intergenic
986307937 5:6529261-6529283 GAAGGGAACCAGGAGGAGCAGGG - Intergenic
986997860 5:13627824-13627846 CAATGGCAACAGGAAGAAGGAGG + Intergenic
987257672 5:16173188-16173210 CAAGCAACAAAGGAGGAAGAAGG + Intronic
987268729 5:16282665-16282687 CTAGAGATACAGGAAGAAGAAGG + Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987497615 5:18668677-18668699 CAAGGGAAGGTGGGGGAAGAAGG + Intergenic
987516874 5:18921271-18921293 GAAGAGAAACAGGGAGAAGATGG - Intergenic
987566412 5:19593670-19593692 GAAGAGAAGGAGGAGGAAGAAGG - Intronic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988673326 5:33405694-33405716 CAAGGGAAACACCTGGGAGAAGG + Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988736431 5:34026515-34026537 CAAGGGAACCAGGAAGTATAAGG + Intronic
988976771 5:36523858-36523880 CAAGGGAAACATGAAGATGAAGG - Intergenic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989404683 5:41046973-41046995 GAAGGGAGATAGGAGGCAGAGGG + Intronic
989458275 5:41667207-41667229 TAGAGGAAACAAGAGGAAGAAGG + Intergenic
989463060 5:41723772-41723794 AAAGGGAAAGAAGAAGAAGAGGG - Intergenic
989981707 5:50653760-50653782 CAAGAGAATCAGGAGGAAGAGGG - Intergenic
990288915 5:54329041-54329063 GAAGAGACACAGAAGGAAGATGG - Intergenic
990426069 5:55690437-55690459 GAAGGGAAAGAGGATGGAGAAGG + Intronic
990501340 5:56399486-56399508 ACAGGGAAAAAGGAGTAAGATGG + Intergenic
990888273 5:60619286-60619308 CAAGGCAATCAGGAAGGAGAAGG + Intronic
991377715 5:65984002-65984024 CACGGGAAGCAGGTGGGAGAAGG - Intronic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
991957711 5:72012437-72012459 CATGGGTTAGAGGAGGAAGAGGG - Intergenic
992258664 5:74948199-74948221 CACTGCAAACAGGAGGAAGCAGG + Intergenic
992322514 5:75627923-75627945 CAACAGATAGAGGAGGAAGAAGG - Intronic
994115269 5:96054827-96054849 CATGTGAAACTGGAGGTAGAAGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994724015 5:103413652-103413674 CAAGGGAAAAAGGAGACAGGAGG - Intergenic
995412681 5:111876342-111876364 CAAGTGATACAGGAGGTAGAAGG - Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995495681 5:112739607-112739629 CAAGCTAAACAGGAGGCTGAGGG + Intronic
995652450 5:114385198-114385220 CAAGAGAAAAAAGAGGAAGATGG - Intronic
995772096 5:115681905-115681927 GAAGGGAAGAAGCAGGAAGAAGG - Intergenic
995909469 5:117168317-117168339 CAAGGGACAAAGGAGAAAGTAGG + Intergenic
995936812 5:117526721-117526743 CAAGGAAAAGAGAAGAAAGAAGG + Intergenic
996617037 5:125454280-125454302 AAAGGGAAACAGCAGGATGAAGG + Intergenic
997804624 5:136905001-136905023 GAAAGGAGAAAGGAGGAAGAAGG - Intergenic
997895728 5:137715148-137715170 AAAGTGCAAAAGGAGGAAGAAGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998419218 5:141968768-141968790 GAAGGTAAACGGGAGGAAGTAGG + Intronic
998510952 5:142713518-142713540 CCTGGGAAACAGGAGGAGAACGG - Intergenic
998647064 5:144074013-144074035 CAAGGCTAACAGGCTGAAGATGG + Intergenic
1000182782 5:158828586-158828608 CAAGGGAAACCTGAATAAGATGG + Intronic
1000349737 5:160343941-160343963 CAAGGGAAGCTGGATGGAGAGGG - Intronic
1001132974 5:169079774-169079796 GAAGGGGAAGAGGAGGAGGAGGG + Intronic
1001845598 5:174918160-174918182 GAAGGGAAAGGGGAGGAAGGTGG - Intergenic
1001905577 5:175470042-175470064 CCAGGGGAGCAGGAGGAAGCTGG + Intergenic
1002331195 5:178442122-178442144 CAAGGGGAAGAGGAGAAAGCAGG - Intronic
1002480669 5:179498661-179498683 CCAGGGAATCTGGCGGAAGAGGG + Intergenic
1002941442 6:1720152-1720174 CAAGGAAAAAAGGAGGAAGTTGG + Intronic
1003415129 6:5900205-5900227 CTAGGGAAGCAGGAGGAAGGAGG + Intergenic
1003569567 6:7247130-7247152 CAAGGCAGACAAGAGGAAGAAGG + Exonic
1004127391 6:12887014-12887036 CAAGGGGAAGAGGAGGAAGAGGG - Intronic
1004319652 6:14622378-14622400 CAAGGGAAAGAGAAGTCAGAAGG + Intergenic
1004469087 6:15912594-15912616 CAAGAGAAAAGGAAGGAAGAAGG - Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006152756 6:31998079-31998101 CAAGAGACACAGAATGAAGAAGG - Intronic
1006159064 6:32030816-32030838 CAAGAGACACAGAATGAAGAAGG - Intronic
1006662640 6:35660999-35661021 TAGGGGAAACAGGAGGAAATGGG + Intronic
1007028858 6:38607985-38608007 GAAGGGAAGGAAGAGGAAGAAGG - Intronic
1007112102 6:39318867-39318889 TAAGTGAAACAGTAGGGAGAAGG - Intronic
1007161961 6:39798824-39798846 CAAGGGAATAAGGAGGAAAAGGG - Intronic
1007485706 6:42179207-42179229 AAAGGGAATCAGGGGGAGGAGGG - Intronic
1007505992 6:42335827-42335849 CATGGGAAGCAACAGGAAGATGG - Intronic
1007617396 6:43188254-43188276 CAAGGTCAAAAGGAAGAAGATGG - Intronic
1007620799 6:43213386-43213408 CAAAGGAAAGAAAAGGAAGAGGG - Intronic
1007691000 6:43701347-43701369 CCAGGGAAAGGGGAAGAAGAGGG - Intergenic
1007893722 6:45324566-45324588 AAAGGGAAAGAGGAGGAATGGGG + Intronic
1007994756 6:46295081-46295103 AAAGGGGCACAGGAGGAAGGAGG + Intronic
1008198733 6:48559850-48559872 CAAAGAAAGCAGGAGGAAGTGGG - Intergenic
1008247365 6:49194391-49194413 AAAGGGAAACAGGAGGGAGGGGG + Intergenic
1008421579 6:51306666-51306688 GAAGGGCAGGAGGAGGAAGAGGG - Intergenic
1008679514 6:53857262-53857284 CAAGGGAAAGCAGAGAAAGAGGG + Intronic
1008836058 6:55831919-55831941 CATGGGTAACAGGAGAGAGAAGG + Intronic
1009288336 6:61851583-61851605 CTAAGGACACAGCAGGAAGATGG + Intronic
1009399532 6:63237879-63237901 CAAGAGAGACAGTAGGAAGGGGG + Intergenic
1009593666 6:65708583-65708605 GAAGGGAAGGAGGAGGAGGAAGG - Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009890698 6:69677507-69677529 AAAGGGGAACAGAAGAAAGAAGG + Intronic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010063386 6:71651091-71651113 CAAGTGAAATAGGAGCTAGATGG - Intergenic
1010111129 6:72234477-72234499 CAAGGTAAACAGGTGGAAAGGGG - Intronic
1011402248 6:86976142-86976164 TATGGAAAACAGGAGGGAGAGGG + Intronic
1012121192 6:95368648-95368670 AAGGGGAAAGAAGAGGAAGAAGG + Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1012693660 6:102351168-102351190 CAAGGGAAATTGGAAAAAGATGG - Intergenic
1013335427 6:109154267-109154289 GGAGGGAAAAAGGATGAAGAGGG - Intronic
1013722578 6:113048654-113048676 CAAGTGAATCATGAGGAGGAGGG - Intergenic
1014143213 6:117967238-117967260 CATGGGAAACAACTGGAAGAAGG + Intronic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1014862565 6:126487772-126487794 TAAGGGAAATAGGAAGATGATGG - Intergenic
1014886774 6:126791470-126791492 GAAGAGAAACAGGAAGAAAAAGG + Intergenic
1015185896 6:130415159-130415181 CAAGGGAAGCAGAAGGAAAGGGG + Intronic
1015804238 6:137092365-137092387 GGAGAGAAACAGGAGGAGGAAGG - Intergenic
1015991470 6:138949031-138949053 CAAGGGAACTATGAGGAAAAGGG + Intronic
1016341938 6:143071740-143071762 GAAGAGAAGAAGGAGGAAGAGGG - Intronic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016590054 6:145734977-145734999 CTAGGGAATCAGTAGGAAGCCGG + Intronic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017485765 6:154900714-154900736 CAAGGAAAGGAGGGGGAAGATGG + Intronic
1017663070 6:156692434-156692456 GCAGAGACACAGGAGGAAGATGG - Intergenic
1017681198 6:156865811-156865833 AAAAGGAAAAAGGAGGAAGGTGG - Intronic
1018152623 6:160954607-160954629 GAAGGGAAAGAGGAGGAGAAGGG - Intergenic
1018571221 6:165212060-165212082 AAATGGCAAGAGGAGGAAGATGG - Intergenic
1018784732 6:167099117-167099139 CAATGGGAGCAAGAGGAAGAAGG + Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019419063 7:942323-942345 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419076 7:942378-942400 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419081 7:942396-942418 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419086 7:942414-942436 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419091 7:942432-942454 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419096 7:942450-942472 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419112 7:942509-942531 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419127 7:942575-942597 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419132 7:942593-942615 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419137 7:942611-942633 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419153 7:942670-942692 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419162 7:942702-942724 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419167 7:942720-942742 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419172 7:942738-942760 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419188 7:942797-942819 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419197 7:942829-942851 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419202 7:942847-942869 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419218 7:942906-942928 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419241 7:943006-943028 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419266 7:943097-943119 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419285 7:943181-943203 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419298 7:943233-943255 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419308 7:943267-943289 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419312 7:943285-943307 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419317 7:943303-943325 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419322 7:943321-943343 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419338 7:943380-943402 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419370 7:943505-943527 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419375 7:943523-943545 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419393 7:943588-943610 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419398 7:943606-943628 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419403 7:943624-943646 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419435 7:943749-943771 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419440 7:943767-943789 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419449 7:943799-943821 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419454 7:943817-943839 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019929711 7:4215455-4215477 CAAGGGCAGCAGGAGGACCAGGG - Intronic
1020032875 7:4945165-4945187 AAAGAGGAAGAGGAGGAAGAAGG - Intronic
1020468983 7:8513985-8514007 GAAGAGAAACAGGGAGAAGATGG - Intronic
1020786027 7:12573379-12573401 AAGGGGAAACAGGAAGAAGTTGG + Intronic
1020875241 7:13685337-13685359 AAAGGGAAACAGCAGGAAATGGG - Intergenic
1021184189 7:17543801-17543823 CTAGTGAAACAGGAAGAAGAAGG + Intergenic
1021274725 7:18636265-18636287 CAGGGGACACAGCAGTAAGAGGG - Intronic
1021312396 7:19110627-19110649 GAAGGAAAACAGGAGGGGGATGG + Intronic
1021572066 7:22076020-22076042 CAAGCTAAACAGGTGAAAGAGGG - Intergenic
1021638684 7:22716992-22717014 CAAGGGAAACAGAGAGGAGAAGG - Intergenic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1022476802 7:30716351-30716373 CAAGGGCTGCAGGAAGAAGAAGG - Intronic
1022491473 7:30823423-30823445 CAAGGAAAAGAGAAAGAAGATGG - Intronic
1022594021 7:31694713-31694735 CAAAGGATAGAGGAGTAAGAGGG + Intronic
1022957954 7:35398712-35398734 CAAGGTAAACGGTGGGAAGAAGG - Intergenic
1023122796 7:36926159-36926181 CAAGGCAAAGAGGTGGAGGAAGG + Intronic
1023655927 7:42420828-42420850 AAAGAGAAAGAGGAGAAAGAGGG + Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024387859 7:48774191-48774213 AAAGGGAAACAAAAGGAAGCTGG - Intergenic
1024808293 7:53175837-53175859 CAAAGGAAACAATAGGCAGAGGG + Intergenic
1024864758 7:53892213-53892235 GAAGGAAAACAGGAGGGACAAGG + Intergenic
1024991024 7:55234561-55234583 CCTGGGAAACAGGAGCAGGAGGG + Intronic
1025174653 7:56792490-56792512 CAAGATAAAAAGGAGGAAGACGG + Intergenic
1025697150 7:63783924-63783946 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025826902 7:65018035-65018057 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025914448 7:65854453-65854475 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025975223 7:66364331-66364353 CAAAATAAAAAGGAGGAAGATGG + Intronic
1026509341 7:71015562-71015584 AAAGGAAGACAGGAGGATGAAGG + Intergenic
1026683591 7:72489209-72489231 CAGGGGAAACAGGCAGAACAAGG + Intergenic
1027408326 7:77886501-77886523 AATGGGAAACAGGAAGAAAAGGG - Intronic
1027689820 7:81330386-81330408 CAAGGGATCCAGAAGGAAAAAGG - Intergenic
1027762112 7:82292250-82292272 CAAGGAAAACATGAGGCAGATGG - Intronic
1027764176 7:82318841-82318863 CAATAGAAAGAGGAAGAAGAAGG + Intronic
1027969917 7:85066328-85066350 GAAGGGAAGTAAGAGGAAGAGGG + Intronic
1028064196 7:86361081-86361103 CAAGGTAAAGAGGATAAAGATGG + Intergenic
1028214312 7:88113053-88113075 CTAGGGAAGCAGGAAGCAGAGGG - Intronic
1028465489 7:91146850-91146872 CAAAGAAAAAAGGAGGCAGATGG - Intronic
1028810795 7:95083379-95083401 CAAGGGAGAAGGGAGGGAGAAGG + Intronic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1030061004 7:105621252-105621274 TAAGGGAACCAGGAGAGAGAGGG - Intronic
1030473911 7:110003582-110003604 GAAGGGAAGGAGGAGGATGAAGG + Intergenic
1030503272 7:110386548-110386570 CAGGGGAAATAGGATGGAGAGGG + Intergenic
1031467100 7:122126153-122126175 CAAAGGAAAAAGCAGGGAGAAGG - Intronic
1031555994 7:123177144-123177166 CAATTGAAATGGGAGGAAGATGG - Intronic
1031762923 7:125737139-125737161 GAAGGGGAAGAAGAGGAAGAAGG + Intergenic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032095539 7:128936888-128936910 GAAGGAAAACAGGAGGGACAAGG - Intergenic
1032238154 7:130141769-130141791 CAAGGTAAACAGGAGGGAAGAGG + Intergenic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1032456424 7:132076457-132076479 CAAGGAACACAGGAGGCAGCTGG - Intergenic
1033041713 7:137925197-137925219 GAGGGGAAGCAGGAGGCAGAGGG + Intronic
1033122962 7:138682556-138682578 CAAGGGAAAGAAGAGGAAAGGGG + Intronic
1033230213 7:139591481-139591503 ACAGGGAAGAAGGAGGAAGAGGG - Intronic
1033563595 7:142557774-142557796 CTAGGGAACCAGGAGGAAAACGG - Intergenic
1033609773 7:142954095-142954117 TAAGGGCACTAGGAGGAAGAAGG + Intronic
1034096091 7:148409194-148409216 AAAGAGAAACAGCAGGAACAGGG + Intronic
1034672099 7:152866714-152866736 GAAGGGAAACAGGAAGGGGAAGG - Intergenic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1035097398 7:156366515-156366537 CACGGGAAACAGGAGAACCAAGG + Intergenic
1035146979 7:156828875-156828897 AAAAGGAAAAAGGAGGAAAAGGG - Intronic
1035217633 7:157380669-157380691 CAAGAGACAGAAGAGGAAGAAGG - Intronic
1035304876 7:157925525-157925547 CAAAGGAAGCTGGAGGGAGAGGG - Intronic
1035458607 7:159025319-159025341 CAAGGGAGAGATGAGGAGGAGGG - Intergenic
1035495991 7:159326607-159326629 CAAAGGGAAAAGGGGGAAGACGG - Intergenic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036059183 8:5295866-5295888 CAAGGGCAAGAGGCAGAAGAGGG + Intergenic
1036602401 8:10274033-10274055 GGAGGGACACATGAGGAAGAAGG - Intronic
1036623345 8:10443844-10443866 CAAGAGAAAAAGGAGGAACAGGG + Intergenic
1036985533 8:13524985-13525007 GAAGGGAGAAAGGAGCAAGAGGG - Intergenic
1037041686 8:14244214-14244236 GAAGAGAAGGAGGAGGAAGAAGG - Intronic
1037041690 8:14244236-14244258 GAAGAGAAGGAGGAGGAAGAAGG - Intronic
1037046960 8:14318221-14318243 GGAGAGGAACAGGAGGAAGAGGG + Intronic
1037325970 8:17691082-17691104 CAAGAGACACTGGAGGAATATGG - Intronic
1037858363 8:22387759-22387781 CAAAGGAAGCAGGAGGAACCTGG - Intronic
1037880262 8:22570203-22570225 CCAGGGACAGAGGGGGAAGAAGG + Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038864005 8:31419067-31419089 CCAGGGCAACAGCTGGAAGAGGG - Intergenic
1039317287 8:36387740-36387762 GAAGGGGAAGAGGAGGAGGAGGG - Intergenic
1040696968 8:50011654-50011676 CAAAGGAAACAGAAGGAACCAGG - Intronic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1041108383 8:54463306-54463328 AAAGAGGAACAGGAGGAGGAAGG - Intergenic
1041521287 8:58759130-58759152 TAAGAGAAACAGGAGGAAGCAGG + Intergenic
1041568006 8:59302730-59302752 GAAGGGAAGAGGGAGGAAGATGG + Intergenic
1041746147 8:61211308-61211330 AAAGGGGAAGAGAAGGAAGAGGG - Intronic
1041880487 8:62744100-62744122 AAAGGAAAGCAGGAGAAAGAAGG + Intronic
1042166938 8:65954985-65955007 CTAGGCAAAAAAGAGGAAGAAGG - Intergenic
1042206768 8:66337460-66337482 GAAGAGATACAGGAAGAAGATGG - Intergenic
1042215275 8:66424952-66424974 CTAGAGGAGCAGGAGGAAGATGG + Intergenic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042454842 8:68989200-68989222 CAAGGCGAACAGGAAGAGGAAGG + Intergenic
1042457085 8:69018417-69018439 CAATGTAGACAGGAAGAAGATGG - Intergenic
1042785651 8:72544146-72544168 CAAGTGGAAAAGGAGGTAGATGG + Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043251133 8:78074645-78074667 CAAGGGGAACACAAGGAAGTGGG - Intergenic
1043320639 8:78981284-78981306 TAAGGGAAAGAGCTGGAAGAAGG + Intergenic
1043657321 8:82685323-82685345 GAAGGGAAATAGAAGGATGAAGG + Intergenic
1043800940 8:84608595-84608617 AAAAGGAAACAGGAGTAATATGG - Intronic
1044249915 8:89993791-89993813 CCAGGAAAACAGGTTGAAGAGGG - Intronic
1044265778 8:90179559-90179581 CAATGGATACAGTAGGAAAATGG - Intergenic
1044602967 8:94024311-94024333 CAAGGTTACCAGGATGAAGAAGG + Intergenic
1045015057 8:97994211-97994233 GAAGGGAAAGAGGAAGGAGAAGG + Intronic
1046126394 8:109914110-109914132 GAAGGAAAACATGAGGAATATGG + Intergenic
1046428204 8:114084121-114084143 CAAAAGAAATAGGAGGAAAAAGG + Intergenic
1046542096 8:115598789-115598811 CAATGGAAACTGGAGGAAGGAGG - Intronic
1046731155 8:117727795-117727817 CAAGGGAAAAAGGATGAGGGAGG - Intergenic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1047815876 8:128461699-128461721 AAAGGGACAAAGGAGGAACATGG + Intergenic
1048106222 8:131413201-131413223 AAAGGGAAGCAGGAGGCAGGAGG + Intergenic
1048199599 8:132360676-132360698 CAAGGGAGACTGGAGGAAAGAGG - Intronic
1048216226 8:132498158-132498180 CAAGGGAAACTGGAAGAGGTGGG - Intergenic
1048722737 8:137345060-137345082 CAAGGGAAACAAAGGAAAGAAGG - Intergenic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049491724 8:142907458-142907480 TAAGGGAAAAAGGAAGAGGAGGG - Intronic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050142802 9:2533950-2533972 TAAAGGCAACAGGTGGAAGAGGG + Intergenic
1050857052 9:10372486-10372508 CAAGGCAAACAGGAACAAGGCGG - Intronic
1050921753 9:11212436-11212458 CAAGGGAAATAGGGGGCTGAAGG + Intergenic
1050929737 9:11308172-11308194 GAAAGGACAGAGGAGGAAGAAGG - Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051132850 9:13882001-13882023 CAAGGGAAGCAGAAAGAAAAGGG + Intergenic
1051425201 9:16925206-16925228 CCAGAGAAGCAAGAGGAAGATGG + Intergenic
1051447811 9:17159668-17159690 AACTGGGAACAGGAGGAAGAGGG + Intronic
1051973926 9:22925576-22925598 GAAGGGTGAAAGGAGGAAGAAGG - Intergenic
1052003681 9:23320221-23320243 GAAAGGAAACAGGAGAAAGAAGG + Intergenic
1052409681 9:28106901-28106923 CATGAGAGACAGGAGTAAGAAGG - Intronic
1053006961 9:34611218-34611240 CAAGGGTATCAGGAGGTAGCTGG + Exonic
1053062439 9:35042930-35042952 GAAGGGGAAGAAGAGGAAGAGGG + Exonic
1053165542 9:35841444-35841466 CAAGGGAAGCACTAGGAAGGAGG - Intronic
1053464911 9:38298902-38298924 AAAGGGAAAAAGGACTAAGAAGG + Intergenic
1053472567 9:38357440-38357462 CAAGAGAGACAGGAGGAAGCTGG + Intergenic
1053566088 9:39253660-39253682 CCAGGGAAGCAGGAGGAAGGTGG - Intronic
1053831855 9:42091475-42091497 CCAGGGAAGCAGGAGGAAGGTGG - Intronic
1054131060 9:61365380-61365402 CCAGGGAAGCAGGAGGAAGGTGG + Intergenic
1054598689 9:67095951-67095973 CCAGGGAAGCAGGAGGAAGGTGG + Intergenic
1055003546 9:71480941-71480963 CAAAGCAAACAGGAAGGAGAAGG - Intergenic
1055408605 9:76002712-76002734 GAAGGGAAACAAGTGAAAGAAGG + Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055729973 9:79270521-79270543 GAAGGGAAACTGGCAGAAGATGG + Intergenic
1055797060 9:79986167-79986189 GAAGGGAAATAGGAGGGAGGTGG + Intergenic
1055815433 9:80199517-80199539 CAAGGGCCCCAAGAGGAAGAAGG - Intergenic
1055950976 9:81729440-81729462 CAAGGTAAAAAAGAGGAAGCAGG - Intergenic
1056120104 9:83479325-83479347 GAAGGGGAAGAAGAGGAAGAAGG + Intronic
1056233410 9:84569519-84569541 CAAGGAAGACAGCAGGGAGATGG - Intergenic
1056597669 9:88021016-88021038 GAAGGAAAAGAGGAAGAAGAAGG - Intergenic
1056876714 9:90340336-90340358 CAAGTGAAACAAGAAAAAGAAGG + Intergenic
1056879332 9:90375742-90375764 CAAGGGAAAAAGAAAAAAGACGG + Intergenic
1057044904 9:91878205-91878227 CAAGGGAAATGGCAGGAAGCAGG + Intronic
1057270974 9:93651367-93651389 CAGTGGAAACAGGAGGCAAAGGG - Intronic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1058555079 9:106158680-106158702 CAAGGTAAACATGTGGAACAGGG - Intergenic
1058672862 9:107375345-107375367 AAAGGGAGCAAGGAGGAAGAGGG + Intergenic
1059048070 9:110892726-110892748 AAAGGGAAAGGGAAGGAAGAGGG + Intronic
1059091249 9:111360963-111360985 CATGGGCAACAGAAGGAAGGAGG + Exonic
1059598256 9:115746690-115746712 TAATGGAAACATGAGGAAGGGGG - Intergenic
1059606154 9:115838654-115838676 CATGTGAAAAGGGAGGAAGAGGG + Intergenic
1059665447 9:116442297-116442319 CTAAGGGAACAGGAGGAACATGG - Intronic
1059883253 9:118715608-118715630 CAAGGGAAAGAGGAAGAAAGAGG - Intergenic
1059972837 9:119685179-119685201 GAAGAGACACAGGAAGAAGATGG - Intergenic
1060055916 9:120412898-120412920 CAGGGGAGAGTGGAGGAAGATGG - Intronic
1060333057 9:122693594-122693616 CTACGGAAACAGGAGCAAAAAGG - Intergenic
1060367526 9:123033589-123033611 GAGGGGAAACAGGGAGAAGAGGG - Intronic
1060914634 9:127379664-127379686 AAATGGAAACAGGAGGAAACTGG + Intronic
1061061852 9:128254462-128254484 GAAGGGAAAGGGGAGGAAGATGG - Intronic
1061108224 9:128548965-128548987 CAAGGTAAGCAGGAGGGACACGG + Intergenic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061922409 9:133789321-133789343 CAAGTGAAACTGGAGGAATTTGG - Exonic
1062085635 9:134646631-134646653 AAAGGGAAACAGGAGGAACGGGG - Intronic
1062246950 9:135574027-135574049 AAAGGCCAACTGGAGGAAGATGG + Intergenic
1062572606 9:137192552-137192574 GAAGAGGAAGAGGAGGAAGAGGG - Exonic
1185488335 X:499860-499882 AAAGGGAAAGGGGAGGAAGGGGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185754624 X:2643431-2643453 AAAGGGAAAGAGGAGGAGAAGGG + Intergenic
1186402591 X:9273577-9273599 AAAAGGAAGAAGGAGGAAGAAGG + Intergenic
1186962497 X:14751703-14751725 AAAGGGTAAAAGGAGCAAGAAGG + Intergenic
1187195988 X:17084078-17084100 CAAGGGATAGAGGAAGAAAAGGG - Intronic
1187356178 X:18573994-18574016 CAAGGCACGCAGGAGGAAAAAGG - Intronic
1187852950 X:23609079-23609101 CAAGGGAGATAGGAGGCAAACGG + Intergenic
1188465828 X:30480018-30480040 TGAGGGAAACAGGACAAAGAAGG - Intergenic
1188532907 X:31162318-31162340 GAAGGCCAACAGGAGGATGAGGG + Intronic
1188735705 X:33712309-33712331 GAAGGGAAAGGGTAGGAAGAAGG + Intergenic
1188904846 X:35779470-35779492 CAAAGGGAAAAGGAGGAATAGGG + Intergenic
1189042089 X:37553569-37553591 AAAGGGAAAAAGGGGGAAGAGGG + Intronic
1189081757 X:37980661-37980683 GAATGGAAACTGGAGGGAGAAGG - Intronic
1189110646 X:38286225-38286247 GAAGGGAAAGGGGAGGAGGAAGG - Exonic
1189110706 X:38286414-38286436 GAAGGGAAAGGGGAGGAAGAAGG - Exonic
1189110795 X:38286717-38286739 GAAGGGAAAGAGGAAGGAGAAGG - Exonic
1189206110 X:39240448-39240470 GAAGGAAGACAGAAGGAAGAGGG - Intergenic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1189578194 X:42377657-42377679 CAAGGGAAGCAGAATGAAAAAGG - Intergenic
1189939986 X:46111832-46111854 TAAGGGAAAAATGAGGAAGATGG + Intergenic
1190236072 X:48616758-48616780 AAAGGGAAGGAGGAGGAAGCAGG + Intergenic
1190493400 X:51004689-51004711 AAAGGGACACTGGAGGAAGAAGG - Intergenic
1190828510 X:54040520-54040542 AATGGGAACCAAGAGGAAGAAGG + Intronic
1190975922 X:55400670-55400692 CAAGGCAATCAGGCAGAAGAAGG + Intergenic
1191006218 X:55714100-55714122 AAGAGGAAAAAGGAGGAAGAGGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1191937699 X:66442880-66442902 GAAGGGAAACAAGAAGAAGTGGG - Intergenic
1192134655 X:68585899-68585921 CATGGGGAGCAGGAAGAAGACGG + Intergenic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1193503422 X:82309285-82309307 CAAGAGAAAAATGAGGAAGAAGG + Intergenic
1194312031 X:92322461-92322483 CAAGGAAAATAGGAAGAAGTGGG + Intronic
1194728177 X:97423554-97423576 TAAGGGAAACATGAAAAAGAAGG + Intronic
1195069655 X:101266930-101266952 CAAGGGAAAAAGTAGGACTAAGG - Intergenic
1195233786 X:102877401-102877423 CCCGGGAAACAGGAAGAAGTGGG - Intergenic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196392785 X:115226123-115226145 CAAGAGAAAAAGGAGGAGGGGGG + Intronic
1196569512 X:117249065-117249087 CAAGGGAAATAGGAGGTGGAGGG - Intergenic
1196731085 X:118942220-118942242 AAAGGGAAGAAGGAGGAAGGAGG + Intergenic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1197107899 X:122737619-122737641 AAAGGGAAAAAGGAGGATCAAGG + Intergenic
1197411413 X:126120739-126120761 CAAGTGACTCAGGAGAAAGAGGG - Intergenic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1198003214 X:132462226-132462248 AAAGAGAAACAGGAGAGAGAGGG - Intronic
1198039919 X:132840423-132840445 GAAGGGGAAGAGGAGGAGGAGGG - Intronic
1198054832 X:132983499-132983521 CCAGGGAGAGAAGAGGAAGAAGG - Intergenic
1198122237 X:133605675-133605697 AGAGGAAAAGAGGAGGAAGAGGG + Intronic
1198321503 X:135521912-135521934 GGAGGGGACCAGGAGGAAGAGGG - Intronic
1199637932 X:149830693-149830715 AAAGGGAAACAGGATGACAAAGG + Intergenic
1199990007 X:152982200-152982222 GAAGTAAAACAGGAAGAAGATGG - Intergenic
1200022060 X:153220111-153220133 CAAGTGAGACAGGGAGAAGAAGG - Intergenic
1200043152 X:153384429-153384451 CAAGGAAAGCAGGAGAGAGAGGG + Intergenic
1200620301 Y:5436576-5436598 CAAGGAAAATAGGAAGAAGTGGG + Intronic
1200663647 Y:5992481-5992503 TAATGGAAATTGGAGGAAGAAGG - Intergenic
1200819323 Y:7566085-7566107 GAAGGGAAAGAGGAGGAGAAGGG + Intergenic
1201458994 Y:14201593-14201615 GGAGGGAAAAAAGAGGAAGAGGG + Intergenic
1202367922 Y:24179535-24179557 GAAAGGAAAGGGGAGGAAGATGG + Intergenic
1202376919 Y:24246373-24246395 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1202493861 Y:25423748-25423770 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1202502861 Y:25490582-25490604 GAAAGGAAAGGGGAGGAAGATGG - Intergenic
1202603435 Y:26618117-26618139 CAAGGGAAAGAGGAAGCAAATGG - Intergenic