ID: 1114295391

View in Genome Browser
Species Human (GRCh38)
Location 14:21324754-21324776
Sequence CGGCAGATGTCAGGAAGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114295391_1114295395 -7 Left 1114295391 14:21324754-21324776 CCAGGCCTTCCTGACATCTGCCG 0: 1
1: 1
2: 0
3: 12
4: 189
Right 1114295395 14:21324770-21324792 TCTGCCGCCCTAGCTCAGGCTGG 0: 1
1: 0
2: 1
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114295391 Original CRISPR CGGCAGATGTCAGGAAGGCC TGG (reversed) Exonic
900463724 1:2813578-2813600 CGGCACCTGTCAGGGAGGCTGGG - Intergenic
900558916 1:3294058-3294080 GGGCACATGGCAGGAACGCCTGG - Intronic
900647733 1:3716568-3716590 TGACAGATGTCAGGGAGGCCTGG - Intronic
902061898 1:13651265-13651287 CAGAATATGTCAGTAAGGCCAGG - Intergenic
902398746 1:16146106-16146128 CGCGAGATGCCAGGAACGCCCGG - Intronic
902766613 1:18620633-18620655 TGCCATGTGTCAGGAAGGCCGGG - Intergenic
904280509 1:29415211-29415233 AGGGAGATGTCAGGAAGGGGAGG + Intergenic
904349287 1:29894442-29894464 CAGGAGATGTCAGGAAGACAGGG - Intergenic
904744664 1:32703197-32703219 CGGCAGCTGTCGTGAAGGGCGGG + Intronic
906249949 1:44303242-44303264 CTGCTAATGTCAGGAAGCCCTGG - Intronic
906314742 1:44779187-44779209 GTGCAGATGTCAGGCAGGTCAGG - Intergenic
918072483 1:181143092-181143114 CAGCAGATGTCACAGAGGCCTGG - Intergenic
918341541 1:183572029-183572051 CAGCAGAGGTCAAGAAAGCCTGG - Intronic
918942942 1:191026052-191026074 CGGCACCTGTCAGGGAGGCTTGG + Intergenic
921067244 1:211631678-211631700 AGGCAGAGGCCAGGAAGCCCTGG + Intergenic
921516531 1:216099131-216099153 ATGCAGAAGTCAAGAAGGCCAGG - Intronic
1067687949 10:48479084-48479106 CGAGGCATGTCAGGAAGGCCGGG - Intronic
1067724771 10:48761734-48761756 GGGCAGAGTTGAGGAAGGCCTGG + Intronic
1069071010 10:63990607-63990629 AGGCAGATGTGAGGAAGGCAGGG + Intergenic
1069634820 10:69918693-69918715 AGGCAGATGTGAGGACAGCCTGG + Intronic
1073797028 10:106999939-106999961 CAGCAGATGTCAGCTGGGCCAGG + Intronic
1075226727 10:120636128-120636150 CAGCAGTTGTCAGGGAGCCCAGG + Intergenic
1075565203 10:123498395-123498417 GGGCATGTGTCAGGAAGACCTGG - Intergenic
1075793569 10:125103193-125103215 CAGCAGCTGTCTGGAAGGCTGGG - Intronic
1080691883 11:34565164-34565186 GGGCTGAAGGCAGGAAGGCCAGG + Intergenic
1080928393 11:36782526-36782548 TGGCAGCTGGCAGGAGGGCCGGG + Intergenic
1081715302 11:45245946-45245968 AGGCAGATGTCAGGAAGGCCAGG - Intronic
1081745237 11:45468266-45468288 AGGCAGGAGGCAGGAAGGCCTGG - Intergenic
1083128302 11:60595932-60595954 CAGCAGATATCATGCAGGCCAGG + Intergenic
1083255978 11:61495758-61495780 AGGCAGCTGCCAGGAGGGCCTGG - Intergenic
1083421616 11:62556472-62556494 CGGCAGATGTGAGGCAGGAAAGG - Intergenic
1084231913 11:67759633-67759655 CTTCAGATTTCAGGAAGGCCAGG - Intergenic
1084962759 11:72725949-72725971 CAGCAGATGGCAGGAAGGGAGGG + Intronic
1085880665 11:80463420-80463442 CAGCAGGTGGCAGGAAGCCCAGG - Intergenic
1086001038 11:81986732-81986754 CGGCACGTGTCAGGGAGGCTCGG + Intergenic
1089930577 11:122306818-122306840 TGGAAGTTGTAAGGAAGGCCAGG - Intergenic
1090363428 11:126188373-126188395 CGGCAGAGGTCAGAAAGCCCAGG - Intergenic
1092019783 12:5191806-5191828 CGTCACAAGCCAGGAAGGCCGGG + Intergenic
1097173440 12:57129507-57129529 GGGCAGAGGGCAGGCAGGCCCGG + Intronic
1100979948 12:100155952-100155974 GGGCAGCTGTCAGCAAAGCCTGG - Intergenic
1101255373 12:102972044-102972066 CCGTAGATGCAAGGAAGGCCAGG + Intergenic
1102006239 12:109590882-109590904 GGGCAGGTTTCAGGAAGGCCAGG + Intronic
1104104535 12:125646497-125646519 TGGAAGATGTCAGGCAGGCAGGG - Intronic
1104598153 12:130133865-130133887 CTGCAGATGTCATGAAGGTAAGG + Intergenic
1106802852 13:33274365-33274387 AGGCAGCTGTCAGCAAGCCCAGG + Intronic
1108720493 13:53126665-53126687 AGGCAGTTGTCAAGAAGGGCTGG + Intergenic
1110571598 13:77010784-77010806 AGGAAAATGTCAGGAAGGCTGGG - Intronic
1111119271 13:83824181-83824203 AGGCAGATGTCAGGATGACATGG + Intergenic
1114295391 14:21324754-21324776 CGGCAGATGTCAGGAAGGCCTGG - Exonic
1115670701 14:35608837-35608859 CTGTAGATGTCAGGTAGGTCCGG - Intronic
1117682425 14:58218092-58218114 AGGCAAATGTAAGGCAGGCCTGG - Intronic
1119085141 14:71732472-71732494 AGGCAGATAACAGGAAGGGCGGG - Intronic
1121022309 14:90587675-90587697 CTGCAAATGCCATGAAGGCCAGG + Intronic
1202924116 14_KI270724v1_random:8407-8429 TGCCTGATGTCAGGAAGGCCAGG - Intergenic
1127534858 15:59880675-59880697 TGATAGCTGTCAGGAAGGCCGGG + Intergenic
1128107287 15:65054391-65054413 CAGCAGATGACAGGAGGGCCAGG + Exonic
1128365078 15:66993940-66993962 GGGGAGATGGCAGGCAGGCCAGG + Intergenic
1129455003 15:75672094-75672116 CGTAAGATGTCGGGAAGCCCTGG - Intergenic
1130748940 15:86688560-86688582 ATGCAGATGTCAGGAGGGCATGG + Intronic
1131646458 15:94350175-94350197 CAGGAGATGTAAGGAAGGGCAGG + Intronic
1132113253 15:99117472-99117494 GGGCAGATGCCAGGCAGGCCTGG + Intronic
1132339527 15:101069197-101069219 CTGGGGATGGCAGGAAGGCCCGG - Exonic
1132540965 16:509589-509611 GTGAAGATCTCAGGAAGGCCAGG + Intronic
1133571508 16:7045059-7045081 CGGAAGATGTGAGGAAAGCATGG + Intronic
1133977842 16:10612782-10612804 GAGCAGAGTTCAGGAAGGCCAGG + Intergenic
1135111068 16:19691240-19691262 CAGCAGATGGCAGGAAGTCGTGG - Intronic
1135282481 16:21164673-21164695 CTGCAGAGCCCAGGAAGGCCAGG - Intronic
1136452133 16:30359437-30359459 GGGCAGAAGCCGGGAAGGCCAGG + Intronic
1137334291 16:47533130-47533152 CTGCAGATGTCAGGACAACCAGG - Intronic
1137567478 16:49542595-49542617 GGACAGATGCCAGGGAGGCCTGG + Intronic
1138113971 16:54345522-54345544 CGGCTGATGTCAGGAGAGACAGG + Intergenic
1139525347 16:67512403-67512425 AGGCAGATGACAGGAATGACAGG + Intergenic
1139735934 16:68988322-68988344 AGTCAATTGTCAGGAAGGCCTGG - Intronic
1140849417 16:78920824-78920846 TGGCTGTTGTGAGGAAGGCCAGG + Intronic
1141471889 16:84244318-84244340 AGTCAGATGTCACCAAGGCCTGG + Intergenic
1141570271 16:84929880-84929902 CAGCTGATGGTAGGAAGGCCTGG + Intergenic
1143575330 17:7789250-7789272 CCACAGATGTCAAGAAGGACGGG + Intronic
1143837161 17:9701584-9701606 CGGCTGCTTCCAGGAAGGCCAGG - Exonic
1144162910 17:12579052-12579074 CGTCAGAGGCCATGAAGGCCAGG - Intergenic
1144948226 17:18980658-18980680 CGGCAGACCCCAGGAAGGACAGG + Intronic
1149863529 17:60137879-60137901 CTGCAGATGTCATGCTGGCCTGG - Intergenic
1150009294 17:61489796-61489818 CGGAGGATGTGAGGGAGGCCTGG - Intergenic
1150484666 17:65535590-65535612 CGGCAGATCTCAGTAATGTCAGG + Intronic
1151928120 17:77213586-77213608 CGGCGGGTGTCAGGAATGCTTGG + Intronic
1152186055 17:78856972-78856994 AGGGAGATGTCTGGAAGGCTAGG - Intronic
1152608559 17:81304830-81304852 CGGCAGAGGGCAGACAGGCCAGG - Intergenic
1155021655 18:21902246-21902268 CGGCAGAGGAAAGGAAGGCTGGG - Intergenic
1156397256 18:36709416-36709438 CGGCATGTGCCAGGGAGGCCTGG + Intronic
1156437419 18:37147553-37147575 GGGCAGATCTCTGGAAAGCCTGG + Intronic
1157291828 18:46415135-46415157 TGGCAGAGGTCATGTAGGCCTGG - Intronic
1159904569 18:74078034-74078056 TGGCAGAAGTCAGGAAGGAGCGG + Intronic
1161332180 19:3693578-3693600 CGGCAGGCGGCAGGGAGGCCTGG + Intronic
1162175305 19:8825881-8825903 CTGCAGCTGTGAGGAAGGCAAGG + Intronic
1163698654 19:18776334-18776356 TGGCACATATCAGGAAGACCCGG + Intronic
1165101105 19:33439272-33439294 AGGCAGGGGGCAGGAAGGCCAGG - Intronic
1165321574 19:35088654-35088676 CGGCATATGTCTGCAGGGCCAGG - Intergenic
1166458328 19:42963747-42963769 GGGGGGATGTCAGGAAGGCTGGG - Intronic
1166475273 19:43119003-43119025 GGGGGGATGCCAGGAAGGCCGGG - Intronic
925025881 2:606965-606987 CGGAAGAATTCAGGAAGGCAGGG - Intergenic
925180659 2:1815106-1815128 AGGCAGATGTCAGGATAGCCAGG + Intronic
925181297 2:1818682-1818704 CAGCATATGTGAGGAAGGGCAGG + Intronic
927936534 2:27079487-27079509 GGGCAGCTGGCAGGAAGGCCTGG - Intronic
928644786 2:33340395-33340417 CAGCAGATTTCAGGCAGGGCGGG + Intronic
934818591 2:97352415-97352437 CAGCAGAAGACAGGAAGGCAGGG - Intergenic
934872383 2:97878911-97878933 AGGCAGATGTGAGAAAGGGCTGG - Intronic
935130053 2:100255001-100255023 TGGGAGAAGTCAGGAAGGCTGGG - Intergenic
937055958 2:118937010-118937032 TTGCAGGTGTCAGGAAGGCAGGG + Intergenic
937422039 2:121765383-121765405 CCGCTGAGGTCAGCAAGGCCAGG - Exonic
946403680 2:219481984-219482006 AGACAGAAGTCAGGAAGACCAGG - Intronic
947206776 2:227667977-227667999 GGGCAGGTGGCAGGGAGGCCAGG - Intergenic
948214659 2:236219826-236219848 AGGCAAAAGTCAGAAAGGCCTGG + Intronic
1168865428 20:1081915-1081937 AGGCAGAAGTGAGGTAGGCCAGG + Intergenic
1171902368 20:30869417-30869439 AGGCTGATGCCTGGAAGGCCTGG + Intergenic
1172886601 20:38235398-38235420 CTGCAGATGTGATGAAGGGCAGG + Intronic
1172949757 20:38715350-38715372 CTGCAGAGGGCAGGAAGCCCAGG + Intergenic
1174417480 20:50377044-50377066 CACCTGATGTCAGCAAGGCCTGG + Intergenic
1175755395 20:61526347-61526369 CCGAGGATGTCAGGAAGGCTGGG - Intronic
1176654154 21:9574968-9574990 CAGCAGGTGTAAGGAAGGCTGGG - Intergenic
1178605550 21:34033690-34033712 CGCCAGAAGACAGAAAGGCCAGG + Intergenic
1178847129 21:36183206-36183228 GGACAGAAGTCAGGGAGGCCAGG - Intronic
1179582636 21:42353033-42353055 CGGCAGATGACAGCAGGGCAGGG - Intergenic
1179654524 21:42837186-42837208 CGGGTGATGGCAGGGAGGCCTGG + Intergenic
1180319449 22:11307187-11307209 AGGCTGATGCCTGGAAGGCCTGG - Intergenic
1181437195 22:22917859-22917881 CAGCTGGTGTCAGGAATGCCAGG - Intergenic
1181888715 22:26042159-26042181 CACCAGGTGTCAGGCAGGCCTGG + Intergenic
1182736970 22:32537680-32537702 AGGAAGAGGTCAGGAAGCCCTGG - Intronic
1184297438 22:43533818-43533840 GGGCAGGTGGCAGCAAGGCCGGG + Intronic
1184920125 22:47600312-47600334 CAGCAGAGATGAGGAAGGCCAGG + Intergenic
1185228058 22:49664370-49664392 CGGGAGATGCCAGGAGGACCTGG - Intergenic
954103928 3:48398949-48398971 GGGCAGAAGTCAGCAGGGCCAGG - Intronic
954223800 3:49170313-49170335 GGCCAGATGTGAGGGAGGCCAGG + Intergenic
954263598 3:49457239-49457261 AGTCAGATGTCAGGAAGGCTTGG + Intergenic
955156510 3:56421983-56422005 AGGCAGAAATCAGGAAGGCTGGG + Intronic
955633798 3:61003786-61003808 AGGCAGATGCCTGGAAGGCATGG - Intronic
957086494 3:75684154-75684176 AGGCAGAGGGCAGCAAGGCCAGG + Intergenic
961099621 3:124187436-124187458 GGGCATATGTCAGGAAGGTGAGG + Intronic
963465169 3:145670337-145670359 AGGAGGATGTCAGGAAGGGCAGG - Intergenic
965529817 3:169760226-169760248 TGTCAGATGTAAGGATGGCCTGG - Intergenic
967104806 3:186247017-186247039 CAGAAAATGTCAGGATGGCCAGG - Intronic
967998487 3:195184975-195184997 AGGTAGAAGTCAGGAGGGCCTGG + Intronic
968092274 3:195906865-195906887 CGGCAGATGTTAGGGAGGAAGGG - Intronic
969735782 4:8989208-8989230 CGACAGCTGTAAGGAAAGCCAGG - Intergenic
981034840 4:140158673-140158695 CAGCTGAGGTTAGGAAGGCCCGG - Intergenic
981931125 4:150190321-150190343 GGATAGATGTCAGAAAGGCCTGG + Intronic
982258270 4:153470898-153470920 GGGCAGGAGTCAGGAAGGACAGG - Intronic
985025777 4:185737695-185737717 GGGCAGATATGAGGAAGGCAAGG + Intronic
985408335 4:189658271-189658293 GGGCAGATGTCATGTGGGCCAGG + Intergenic
985533466 5:447624-447646 TGGCAGACGTCAGCAAGGACTGG + Exonic
985947297 5:3196137-3196159 CGGCAGAGGACAGGAGGGACTGG + Intergenic
986830512 5:11572170-11572192 CAGCAGATGTCACAAAGACCTGG - Intronic
989293741 5:39799139-39799161 GGGCAGCTATCAGGAAGGGCAGG + Intergenic
995875489 5:116784839-116784861 CGGCATAAGGCAGGAAGGGCCGG - Intergenic
998128278 5:139638392-139638414 GGGCAGATGTCACGCAGCCCAGG + Intergenic
998694317 5:144621613-144621635 CGGGAGATGGCAGGAAATCCTGG + Intergenic
999737319 5:154522333-154522355 GGGCAGGTGTAAAGAAGGCCTGG + Intergenic
1001546401 5:172573133-172573155 AGCCAGGAGTCAGGAAGGCCTGG + Intergenic
1002054325 5:176590046-176590068 AGGCAGATGTCACAGAGGCCTGG - Intronic
1002160733 5:177312572-177312594 GGGCAGATGGCAGGCAGGCTTGG - Intronic
1002416153 5:179121914-179121936 CGGCTGCTGTCAGGAGGGGCAGG - Intronic
1002850819 6:995189-995211 CTTCAGATCTCAGGGAGGCCGGG + Intergenic
1003364644 6:5460844-5460866 ACTCAGTTGTCAGGAAGGCCAGG + Intronic
1006409400 6:33863575-33863597 CCGCACATGACACGAAGGCCTGG - Intergenic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1014882862 6:126745036-126745058 TGGAGGTTGTCAGGAAGGCCAGG + Intergenic
1018027486 6:159817391-159817413 CCGCAGATGTCAGGAGGCCAAGG + Intronic
1018919486 6:168161459-168161481 CGGGGGATGGCAGGACGGCCAGG - Intergenic
1018940412 6:168305878-168305900 AAGCAGATTTCAGGAAGGGCAGG + Intronic
1018956567 6:168414067-168414089 CGACAGACGTCAGGGAGCCCAGG + Intergenic
1019005417 6:168792612-168792634 CAGCGGATGTCAGGAATTCCTGG + Intergenic
1020418058 7:7968926-7968948 CGGCAGCTGCAAGGAGGGCCGGG - Exonic
1023966784 7:44967001-44967023 GGGCAGAGGCCAGCAAGGCCAGG + Intronic
1026361535 7:69605366-69605388 AGGCAGATGTCAGGCAGGAAAGG - Intronic
1028368301 7:90060889-90060911 CGGCAGATATCTGGAATGCTGGG + Intergenic
1032264534 7:130361845-130361867 CATCAGCTGTCAGGAAGGGCAGG + Intronic
1035581836 8:744983-745005 CGGCAGGTGTGGGGATGGCCTGG - Intergenic
1037699486 8:21261952-21261974 GGGCAGATGGGAGGAGGGCCAGG - Intergenic
1038612810 8:29070563-29070585 GGGCAGCTGTCAGCGAGGCCAGG + Exonic
1042175620 8:66034793-66034815 GGGCAGGTGTCTGGAAGGGCTGG + Intronic
1043150077 8:76704586-76704608 CAGCAGATGCCAGGGAGTCCAGG - Exonic
1043523543 8:81072375-81072397 CCCCAAATGTCAGCAAGGCCAGG - Intronic
1044849904 8:96418074-96418096 CTACAGATGTCAGCAAGGCCAGG + Intergenic
1047725844 8:127683278-127683300 AGGCAGATGGCAGAAAGGCTGGG + Intergenic
1049654602 8:143792066-143792088 CAGCAGGTCCCAGGAAGGCCGGG - Exonic
1051731107 9:20143912-20143934 CTGTAGAGGTCAGGAAGGCACGG - Intergenic
1057274207 9:93667646-93667668 CTGCAGCTGTCAAGAAGACCAGG - Intronic
1060269676 9:122131814-122131836 CAGGAGATGGCAGGAGGGCCCGG - Intergenic
1060283504 9:122228909-122228931 CGGCAGCAGCCAGGGAGGCCGGG - Intronic
1061486378 9:130922556-130922578 CAGCAGATGTCAGAGAGGCGGGG - Intronic
1062126965 9:134869150-134869172 AGGCAGGTGGCAGGAAGCCCCGG - Intergenic
1062476308 9:136729046-136729068 AGGCAAAGGCCAGGAAGGCCGGG + Intergenic
1062534186 9:137014388-137014410 CGGCAGATGTGAAGGAGTCCAGG - Exonic
1203367681 Un_KI270442v1:272937-272959 AGGCTGATGCCTGGAAGGCCTGG - Intergenic
1203631877 Un_KI270750v1:78426-78448 CAGCAGGTGTAAGGAAGGCTGGG - Intergenic
1187479921 X:19645954-19645976 AGGCAGAAGTCAGGATGTCCAGG + Intronic
1190279844 X:48922435-48922457 CGGCAGGTGTCAGGCCGGCTTGG - Exonic
1192362559 X:70448856-70448878 GGGCAGATGGCTGGAAGGGCAGG + Intronic
1193364016 X:80608803-80608825 TAGCTGATGTCAGCAAGGCCAGG - Intergenic
1194458097 X:94129621-94129643 TGGTAGATGCCAGGAAGGCTGGG + Intergenic
1197897405 X:131330095-131330117 GGGCAGATGACAGGAAAGGCAGG + Intronic
1198003536 X:132466623-132466645 CTGTAGATCTCATGAAGGCCAGG - Intronic
1199850647 X:151723047-151723069 CCGCTGAGGTCAGGAAGGCAAGG - Exonic
1200010188 X:153114666-153114688 CTGCAGAGGTCAGAAGGGCCTGG - Intergenic
1200029412 X:153285256-153285278 CTGCAGAGGTCAGAAGGGCCTGG + Intergenic