ID: 1114301751

View in Genome Browser
Species Human (GRCh38)
Location 14:21384818-21384840
Sequence ATGAACTGCAGCAAGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114301751_1114301756 -1 Left 1114301751 14:21384818-21384840 CCAGTCCCCTTGCTGCAGTTCAT No data
Right 1114301756 14:21384840-21384862 TGAAAACTGGCACTATTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114301751 Original CRISPR ATGAACTGCAGCAAGGGGAC TGG (reversed) Intergenic
No off target data available for this crispr