ID: 1114302470

View in Genome Browser
Species Human (GRCh38)
Location 14:21390692-21390714
Sequence TGCTTGAACCCGGCGGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152240
Summary {0: 3, 1: 127, 2: 6331, 3: 40070, 4: 105709}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114302462_1114302470 17 Left 1114302462 14:21390652-21390674 CCTGTAATCCCAGCTACTCAGGA 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651
Right 1114302470 14:21390692-21390714 TGCTTGAACCCGGCGGGCGGAGG 0: 3
1: 127
2: 6331
3: 40070
4: 105709
1114302465_1114302470 8 Left 1114302465 14:21390661-21390683 CCAGCTACTCAGGAGGCTGATGC 0: 436
1: 90059
2: 197367
3: 232484
4: 157299
Right 1114302470 14:21390692-21390714 TGCTTGAACCCGGCGGGCGGAGG 0: 3
1: 127
2: 6331
3: 40070
4: 105709
1114302464_1114302470 9 Left 1114302464 14:21390660-21390682 CCCAGCTACTCAGGAGGCTGATG 0: 683
1: 103726
2: 209507
3: 242999
4: 150565
Right 1114302470 14:21390692-21390714 TGCTTGAACCCGGCGGGCGGAGG 0: 3
1: 127
2: 6331
3: 40070
4: 105709

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114302470 Original CRISPR TGCTTGAACCCGGCGGGCGG AGG Intronic
Too many off-targets to display for this crispr