ID: 1114304530

View in Genome Browser
Species Human (GRCh38)
Location 14:21409966-21409988
Sequence TTCACCAGGTAGTAAATAAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114304524_1114304530 12 Left 1114304524 14:21409931-21409953 CCCATGTGCTATCCTCATAGGGC 0: 1
1: 2
2: 1
3: 2
4: 70
Right 1114304530 14:21409966-21409988 TTCACCAGGTAGTAAATAACGGG 0: 1
1: 0
2: 0
3: 9
4: 135
1114304525_1114304530 11 Left 1114304525 14:21409932-21409954 CCATGTGCTATCCTCATAGGGCA 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1114304530 14:21409966-21409988 TTCACCAGGTAGTAAATAACGGG 0: 1
1: 0
2: 0
3: 9
4: 135
1114304526_1114304530 0 Left 1114304526 14:21409943-21409965 CCTCATAGGGCAGAGAGCACCAT 0: 1
1: 0
2: 2
3: 7
4: 144
Right 1114304530 14:21409966-21409988 TTCACCAGGTAGTAAATAACGGG 0: 1
1: 0
2: 0
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114304530 Original CRISPR TTCACCAGGTAGTAAATAAC GGG Exonic
907007545 1:50931025-50931047 TTCTCTAGGTTGTAAATAAAAGG - Intronic
908070259 1:60452774-60452796 TTACCCAGGTAGTAAACATCAGG + Intergenic
911489019 1:98539310-98539332 TTCACATTGTTGTAAATAACAGG + Intergenic
911877734 1:103190232-103190254 TGCACCAGTTAAAAAATAACAGG - Intergenic
912972318 1:114295195-114295217 TTCTCCAGGGAGTAAATCCCTGG - Intergenic
916144707 1:161727885-161727907 ATCACAATGTAGTAAATAACAGG - Exonic
916175042 1:162031086-162031108 TATACCAGAGAGTAAATAACAGG + Intergenic
919239451 1:194892612-194892634 TTCACCAGTTAATAAATATTTGG - Intergenic
921358515 1:214308617-214308639 TTCAGCTGCTAGTAATTAACTGG + Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
924689890 1:246336949-246336971 TTCACCAAGTATTAAATCACAGG + Intronic
1063118971 10:3091171-3091193 TTCACCAGGTAGAAAGGAATGGG - Intronic
1064046934 10:12025177-12025199 ATCACCATGTAGAAAATAATTGG - Intronic
1066136653 10:32453952-32453974 TTCACCAGTTAGTAAATATTTGG - Intronic
1075733317 10:124649129-124649151 TTCACCAGGTACATAATGACAGG + Intronic
1082800329 11:57409703-57409725 TTCACCAGGTAGAAAACAGAGGG + Intronic
1087191328 11:95257616-95257638 TTTTCCAGGCAATAAATAACTGG - Intergenic
1088240707 11:107771076-107771098 TTCACCAGTTATTAATTATCAGG + Intergenic
1092582974 12:9866511-9866533 TACAACAGGAAGTAAATAAAAGG + Intronic
1092768728 12:11877555-11877577 TTCACCTGGTACTAAAACACTGG - Intronic
1093274802 12:17111574-17111596 CTCAGCAGGTAGTTAATAGCTGG - Intergenic
1094069783 12:26400649-26400671 TTCTATAGGTAGAAAATAACAGG + Intronic
1095806596 12:46326483-46326505 TTCATCAGCTAGTAAATATTTGG - Intergenic
1098106523 12:67073286-67073308 TTCACCTGGTAGGAAAGAAAAGG + Intergenic
1098169191 12:67729057-67729079 TTACGCAGGTAGTAAATAAGTGG + Intergenic
1098391978 12:69979307-69979329 TTCTCTAGGTAGTAAATATGGGG + Intergenic
1103229698 12:119318852-119318874 TTCACCAGATAGTAGCTAAAAGG - Intergenic
1109587176 13:64421741-64421763 TTCACAAGGTAATTAATAAGTGG - Intergenic
1111329383 13:86743964-86743986 TTCTCCTGGCAGTAAATATCAGG - Intergenic
1114131437 14:19798057-19798079 TTCACTATGTTGAAAATAACTGG - Intronic
1114288619 14:21269640-21269662 TTCTCCAGGCAATAAATGACAGG - Intergenic
1114304530 14:21409966-21409988 TTCACCAGGTAGTAAATAACGGG + Exonic
1114932091 14:27485847-27485869 CTCACCAGGAACTAAATTACTGG - Intergenic
1115433971 14:33352559-33352581 TTCACCAACTAGTAAATGCCAGG + Intronic
1116117837 14:40679859-40679881 TTCAGGAGGTTGTAAGTAACTGG + Intergenic
1117171064 14:53097089-53097111 CTCACCAGTTAATAAATTACAGG + Intronic
1120840930 14:89084228-89084250 TTCCCCTGGTTGTAAATACCTGG + Intergenic
1121752191 14:96366258-96366280 TTCAGCAGTTATTAAATAAGTGG + Intronic
1123574501 15:21653760-21653782 TTCACTATGTTGAAAATAACTGG - Intergenic
1123611115 15:22096256-22096278 TTCACTATGTTGAAAATAACTGG - Intergenic
1131803524 15:96097681-96097703 TTCACCAGGTTTTAAACAGCAGG - Intergenic
1202983363 15_KI270727v1_random:388012-388034 TTCACTATGTTGAAAATAACTGG - Intergenic
1134845223 16:17434303-17434325 ATCACCTGCTAGTAAATTACAGG + Intronic
1137776819 16:51062234-51062256 CTCACCTGCTGGTAAATAACAGG - Intergenic
1137997242 16:53231647-53231669 TTTACTAAGTAGTAAATAACAGG - Exonic
1138825563 16:60315120-60315142 TTCTCCAGGATGTAAATACCGGG + Intergenic
1139036190 16:62949444-62949466 TTCACTGGGTAGAAAATATCAGG - Intergenic
1140273610 16:73488100-73488122 TTCACTTGGCAATAAATAACTGG + Intergenic
1140962840 16:79933437-79933459 TTCTACAGGAAGTTAATAACTGG + Intergenic
1144139058 17:12329786-12329808 TTCAATAGGTGGAAAATAACAGG + Intergenic
1145000873 17:19303800-19303822 TACACCAGGTAATATTTAACAGG - Intronic
1147360239 17:39925650-39925672 TTATCCTGGAAGTAAATAACTGG - Exonic
1147458147 17:40551555-40551577 TTCACCATCTAGAAAATGACTGG + Intergenic
1150367157 17:64599352-64599374 TGGACCACGTAGTAAATAAGAGG - Intronic
1150955044 17:69848432-69848454 TGCACCAGGTACTAAAAAACAGG + Intergenic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1153395410 18:4614824-4614846 TGCACAGGGTAGTAAAAAACAGG + Intergenic
1157509184 18:48256400-48256422 TTCACCATGTAGAAAATTCCAGG - Intronic
1159595970 18:70383122-70383144 TTCACCAGGGAATAAACAGCAGG - Intergenic
1166139215 19:40796875-40796897 GCCTCCAGGTAATAAATAACAGG - Exonic
1166396522 19:42445166-42445188 TCCACCATCTAGTAAATACCAGG - Intergenic
926690560 2:15730554-15730576 ATTACAAGGAAGTAAATAACTGG - Intronic
928372967 2:30754505-30754527 GTCAACAGGTAGAGAATAACTGG - Intronic
928727238 2:34188868-34188890 TTCTGCAGCTAGTATATAACAGG + Intergenic
930789494 2:55309390-55309412 TTCATCAGGTAGTTAACAATGGG + Intronic
933325807 2:80835477-80835499 TTCCACAAGTGGTAAATAACAGG - Intergenic
935309426 2:101768854-101768876 TTCACCACGGAGCAAATAAAAGG - Intronic
937421844 2:121763512-121763534 GTCACCAGGTAGTCACTGACTGG + Intronic
941393833 2:164949690-164949712 TTCACCAGGTAGAGAAGAAAAGG + Intronic
941928561 2:170918968-170918990 TTCAACAGGAAGGAAATATCTGG + Intergenic
943008249 2:182413211-182413233 TTCACTTGGTAGAAAATAAAGGG + Intronic
946526119 2:220522239-220522261 TTTAGCAGATAGTAAATACCAGG + Intergenic
947050722 2:226039752-226039774 TGCTCCAGGTAGAGAATAACAGG - Intergenic
947344479 2:229176727-229176749 TTCACCATGTAGTTAACAAAGGG + Intronic
1170804843 20:19620539-19620561 TTCACCAGGGAGCAAACAGCTGG + Intronic
1173132371 20:40406555-40406577 TTCACCAGGTATCAAAGACCTGG + Intergenic
1177183568 21:17769315-17769337 CTAACCAGGCAGTAAATTACAGG - Intergenic
1177972073 21:27802634-27802656 TTCATTAGGTAGTAAAGAACTGG + Intergenic
1182192713 22:28479635-28479657 TTCACGGGGCAGTAGATAACAGG + Intronic
952813113 3:37422755-37422777 TACACCAGGTAGCAACTATCTGG + Intronic
953393847 3:42550737-42550759 TTCAGCAGGCAGTAAAGAAACGG - Intronic
955805794 3:62732731-62732753 TGCACCTGGTACTAAATGACAGG + Intronic
956537878 3:70298846-70298868 TCACCCAGGTAGTAAACAACAGG - Intergenic
958959058 3:100492106-100492128 TTCTCCAGGGAGCAAATAATAGG - Intergenic
958980420 3:100712603-100712625 TTCAACAGCTATTAAATAAAGGG - Intronic
962823685 3:139079239-139079261 TTCACCAGCTATTAAAGAAAAGG + Intronic
964736643 3:159925036-159925058 TACTCCAGGAAGTAAATGACTGG + Intergenic
965878868 3:173364011-173364033 TTCAGCAGGTAAAAAATATCAGG - Intergenic
968141947 3:196265560-196265582 ATCACCAAGTAGTAGATACCTGG - Intronic
970080258 4:12275601-12275623 TTCACCAGGTTGGAAATATTCGG - Intergenic
970220908 4:13809776-13809798 TCCACCAGGAAATAAATAAAGGG - Intergenic
970940136 4:21622157-21622179 GTCACCAGGTAGCAACTACCAGG + Intronic
971629879 4:28977286-28977308 TTCACCAGGCAGAAAATAAGAGG - Intergenic
971637821 4:29085861-29085883 TATACAAGGTAGAAAATAACAGG + Intergenic
975481404 4:74884543-74884565 TTCATCAGGCAGTAAATGTCAGG - Intergenic
979289293 4:118962069-118962091 TTCATCAGGTAGTAGATGGCTGG + Intronic
979691041 4:123558887-123558909 TGCAGCAGGTAGTAAATGAATGG + Intergenic
983297683 4:165886910-165886932 TTCTCCAGGAAGAAAATCACAGG - Intronic
987127445 5:14827606-14827628 CTCATCAGGTAGCAGATAACTGG + Intronic
987789320 5:22544256-22544278 TTCATCAGATTGTAAACAACAGG - Intronic
987849182 5:23326662-23326684 TTCATCAGGTGATGAATAACGGG - Intergenic
988723377 5:33901384-33901406 TCAACCAAGTAGAAAATAACGGG + Intergenic
991095993 5:62740091-62740113 CTTACCAGGAAGTTAATAACAGG - Intergenic
991629764 5:68644887-68644909 TTGCCAAGGTAGTAAATGACTGG + Intergenic
994193549 5:96896497-96896519 ATAACAAGGTAGTAAATATCAGG + Exonic
995542781 5:113200925-113200947 TTGACCATGTAGTAGATAAAGGG + Intronic
996486138 5:124037099-124037121 TACACCAGGTAGCAAAGAAGAGG + Intergenic
996584711 5:125072478-125072500 TTCACAAGGGTGTGAATAACAGG + Intergenic
999348318 5:150844047-150844069 TTCATCAGGTATTAAATGATTGG - Intergenic
1000857844 5:166421606-166421628 TTCACCATGCAATAAAGAACAGG - Intergenic
1003603069 6:7535944-7535966 TTTACCAGTTTTTAAATAACTGG + Intergenic
1005706771 6:28462806-28462828 TTCACCAGGGAGGAAATGTCTGG - Intergenic
1009316277 6:62224781-62224803 TTCACCAAGTAGCATATAAAAGG - Intronic
1012656844 6:101835121-101835143 TTCACCAGGCAATAAATGAATGG - Intronic
1013005886 6:106072988-106073010 TTCACCATGTGGCAATTAACAGG + Intergenic
1013176358 6:107680656-107680678 CTCACCAGGCAATAAATAAAAGG - Intergenic
1013558617 6:111282813-111282835 TTCTCATGGTAGTAAATAAGGGG - Intergenic
1014899485 6:126945306-126945328 GTCACCAGAGAATAAATAACTGG - Intergenic
1016096874 6:140048971-140048993 TTCAGCAGGTAATAAATTATAGG - Intergenic
1016500090 6:144710803-144710825 TATACTAGGTGGTAAATAACAGG - Intronic
1020693252 7:11385312-11385334 TTCACTAGGTTGAAAATAAGTGG + Intronic
1021232760 7:18105823-18105845 TTCACCAGGTGGTAAACATTTGG - Intronic
1022055289 7:26725409-26725431 ATCACCAGAAAGTAAATACCTGG + Exonic
1022109378 7:27219265-27219287 TTCCCGAGGCAGTAAATACCGGG - Intergenic
1022772997 7:33494510-33494532 TACCACAGGTTGTAAATAACTGG - Intronic
1024178059 7:46861326-46861348 TTCAGCAGGAATTAGATAACAGG + Intergenic
1027509689 7:79064801-79064823 TTCACTAGGTTGTAGATAATTGG + Intronic
1030827627 7:114180039-114180061 TAGACCATGTAGTACATAACAGG + Intronic
1037676409 8:21054731-21054753 CTCACCAGGCAGTAAATCAAGGG + Intergenic
1038956629 8:32475062-32475084 TTCACAAGGTAGTAAAAGCCAGG - Intronic
1041703705 8:60821790-60821812 TTCACCAGATAGTGAGTCACAGG - Exonic
1047652964 8:126944553-126944575 TTCACCTAGCAGTAATTAACAGG + Intergenic
1052790860 9:32874300-32874322 TTAACCAGGAATTAAAGAACTGG - Intergenic
1055400278 9:75916477-75916499 TTGACCAGATAGAAAGTAACTGG + Intronic
1056956658 9:91087585-91087607 TTCACAAGGGAGTGAATACCAGG + Intergenic
1186009983 X:5119225-5119247 AACACCAGGTACTAAATAACAGG - Intergenic
1186551673 X:10512370-10512392 TTAACCAAGTAATAAGTAACTGG - Intronic
1188054889 X:25529453-25529475 GTCTCCAGGCACTAAATAACTGG - Intergenic
1193899954 X:87165059-87165081 TACACAAGGTCATAAATAACAGG - Intergenic
1195470357 X:105222783-105222805 TTCTCCAACTAGTCAATAACAGG - Intronic
1197724543 X:129767892-129767914 AACCCCAGGTAGTGAATAACTGG + Intronic
1198446293 X:136718985-136719007 TTTACCAAGTATTAAATCACAGG - Intronic
1198741315 X:139846219-139846241 TTCACCAGGTTGGAAACAACTGG - Intronic
1202365842 Y:24163870-24163892 TTCACTAGGTACTAAAAAATGGG - Intergenic
1202504940 Y:25506252-25506274 TTCACTAGGTACTAAAAAATGGG + Intergenic