ID: 1114310064

View in Genome Browser
Species Human (GRCh38)
Location 14:21458284-21458306
Sequence CTTCAAAAACCAATGGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114310058_1114310064 15 Left 1114310058 14:21458246-21458268 CCTACACTGATCTTAGTATGATT No data
Right 1114310064 14:21458284-21458306 CTTCAAAAACCAATGGACATTGG No data
1114310057_1114310064 28 Left 1114310057 14:21458233-21458255 CCAATTTCTGGTACCTACACTGA No data
Right 1114310064 14:21458284-21458306 CTTCAAAAACCAATGGACATTGG No data
1114310061_1114310064 -9 Left 1114310061 14:21458270-21458292 CCAATGGTCTTGGCCTTCAAAAA No data
Right 1114310064 14:21458284-21458306 CTTCAAAAACCAATGGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114310064 Original CRISPR CTTCAAAAACCAATGGACAT TGG Intergenic
No off target data available for this crispr