ID: 1114315942

View in Genome Browser
Species Human (GRCh38)
Location 14:21510194-21510216
Sequence GGTCTAATTAGACAAAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114315942_1114315948 21 Left 1114315942 14:21510194-21510216 CCTTATTTTTGTCTAATTAGACC 0: 1
1: 0
2: 4
3: 14
4: 196
Right 1114315948 14:21510238-21510260 AGAAAGGTAATTAATTAGGTGGG 0: 1
1: 0
2: 0
3: 26
4: 333
1114315942_1114315946 17 Left 1114315942 14:21510194-21510216 CCTTATTTTTGTCTAATTAGACC 0: 1
1: 0
2: 4
3: 14
4: 196
Right 1114315946 14:21510234-21510256 CTCAAGAAAGGTAATTAATTAGG 0: 1
1: 0
2: 0
3: 20
4: 294
1114315942_1114315949 24 Left 1114315942 14:21510194-21510216 CCTTATTTTTGTCTAATTAGACC 0: 1
1: 0
2: 4
3: 14
4: 196
Right 1114315949 14:21510241-21510263 AAGGTAATTAATTAGGTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 170
1114315942_1114315945 5 Left 1114315942 14:21510194-21510216 CCTTATTTTTGTCTAATTAGACC 0: 1
1: 0
2: 4
3: 14
4: 196
Right 1114315945 14:21510222-21510244 ACACTGTAGATACTCAAGAAAGG 0: 1
1: 0
2: 0
3: 27
4: 230
1114315942_1114315947 20 Left 1114315942 14:21510194-21510216 CCTTATTTTTGTCTAATTAGACC 0: 1
1: 0
2: 4
3: 14
4: 196
Right 1114315947 14:21510237-21510259 AAGAAAGGTAATTAATTAGGTGG 0: 1
1: 0
2: 2
3: 35
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114315942 Original CRISPR GGTCTAATTAGACAAAAATA AGG (reversed) Intronic
900881549 1:5385339-5385361 GCTCTAATTAGACATAAAAGGGG + Intergenic
900985328 1:6069848-6069870 GGACTAATTTAACAAAACTAGGG - Intronic
907092921 1:51745873-51745895 GGCATAATTAGAAAAAAATAAGG + Intronic
909359736 1:74746371-74746393 GGTATAATGAGACTAAAATAAGG - Intronic
910243054 1:85109164-85109186 GTTTTAATTTGAGAAAAATATGG + Intronic
911232576 1:95376675-95376697 AGTCAAATAAGACAAAAATTAGG + Intergenic
911640796 1:100286583-100286605 GGACTAAGGAGACAAAAGTATGG - Intronic
913183257 1:116343275-116343297 GGACTAATTAGTCCAAAACAGGG + Intergenic
913577178 1:120188024-120188046 GGTCTAATTAAAAAAAAATAAGG + Intergenic
914559091 1:148799459-148799481 GGTCTAATTAAAAAAAAATAAGG + Intergenic
914613742 1:149330770-149330792 GGTCTAATTAAAAAAAAATAAGG - Intergenic
915688142 1:157657557-157657579 AATATTATTAGACAAAAATAAGG + Intergenic
916547038 1:165815584-165815606 GGTCATATTAGAGACAAATAAGG + Intronic
918005342 1:180536646-180536668 TGCCTAATTAGCCAAAAATCTGG - Intergenic
918314882 1:183315130-183315152 GGTCTATCTCAACAAAAATATGG + Intronic
919533104 1:198750472-198750494 GCTCTTTTTAGACAAAAAAAGGG - Exonic
920688519 1:208128227-208128249 TGTCTTATGAGACAAGAATAAGG - Intronic
921563923 1:216693296-216693318 TGTGTAATTAAAGAAAAATAGGG + Intronic
921676516 1:217982538-217982560 AGTCTAATTAGTGAAAAATTGGG - Intergenic
921761314 1:218918459-218918481 GGTATAATTAAACAAAAAGGAGG + Intergenic
922587926 1:226749892-226749914 AGAATAATAAGACAAAAATAAGG + Intergenic
922984354 1:229854326-229854348 GGTCTTATCAGAAAAAAAAAAGG + Intergenic
924162578 1:241248150-241248172 AGTCTTATTAGACATAAAAAGGG - Intronic
924222418 1:241891835-241891857 TTTCTAATTAAACAAAAATTGGG - Intronic
1065239599 10:23693116-23693138 TAGCTAATTAGACAAAATTATGG - Intergenic
1067022465 10:42813252-42813274 GGTCTAAATAAACCAAAAGACGG - Intronic
1071224112 10:83508101-83508123 GCTATAATGAAACAAAAATAAGG + Intergenic
1076453165 10:130570840-130570862 GGTCCTATTACACAAACATAGGG - Intergenic
1078957986 11:16224645-16224667 GGTATAATTAAAAAAAACTATGG + Intronic
1079382093 11:19947294-19947316 GGTCCAATCTGAGAAAAATAAGG + Intronic
1079517746 11:21289041-21289063 GATCAAATTAGGCAATAATAGGG + Intronic
1080063590 11:27983530-27983552 GGTCTACTTTGACACAACTAGGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1085493422 11:76944914-76944936 AATCCAATCAGACAAAAATAGGG - Intronic
1086877525 11:92114166-92114188 GACCCAATTAGACAAAAATAAGG + Intergenic
1090726988 11:129537114-129537136 TGTCCAATAAGACAGAAATAAGG - Intergenic
1090985926 11:131766093-131766115 GGTCTAAAAAGACAAGAGTATGG - Intronic
1091223509 11:133944668-133944690 GGTCTCCTGAGACAAAAGTAAGG + Intronic
1093103071 12:15051303-15051325 TGTTTAAGAAGACAAAAATATGG + Intergenic
1093614173 12:21201458-21201480 ACTCTTATTAGACAAAGATATGG + Intronic
1096702885 12:53397968-53397990 GGTCTTATCAGACAATGATATGG + Intronic
1097584666 12:61500712-61500734 GGTATAACTAGAGAAAAATATGG + Intergenic
1099504610 12:83457654-83457676 GGTTTTATTAGACAAACACAAGG + Intergenic
1101484845 12:105145756-105145778 GCTCTAATTAGAAAAAACTATGG + Intronic
1104496248 12:129242367-129242389 GGTCTACGTAGACATAAAAATGG - Intronic
1104703189 12:130922736-130922758 TCTCTAATTACAAAAAAATAAGG + Intergenic
1107042293 13:35961877-35961899 AGTGTAATCAGACATAAATAAGG + Intronic
1109040699 13:57332135-57332157 GGACTAATTAAACAGAAAAAAGG + Intergenic
1110006221 13:70274178-70274200 GCTCTAATATGACAAGAATATGG - Intergenic
1111149956 13:84238658-84238680 GGTATAATAAGTCAGAAATATGG - Intergenic
1112072857 13:95874110-95874132 GGAATAAGCAGACAAAAATAAGG - Intronic
1112642771 13:101295576-101295598 TGTCCAATTAGAAAAAAAAATGG - Intronic
1113159223 13:107360888-107360910 GGCTTTATTAGCCAAAAATATGG - Intronic
1114315942 14:21510194-21510216 GGTCTAATTAGACAAAAATAAGG - Intronic
1115976966 14:39007427-39007449 GGTTTAATAAAAGAAAAATAAGG + Intergenic
1116366282 14:44069039-44069061 GGTCTAATTAGAACTAGATAGGG - Intergenic
1116558160 14:46339860-46339882 ATTCTAATTGGAAAAAAATAAGG - Intergenic
1118523122 14:66609643-66609665 ATTCAACTTAGACAAAAATAAGG - Intronic
1120221169 14:81735470-81735492 GATTTAATTAGAGAAAGATAAGG - Intergenic
1120336453 14:83163025-83163047 TTTCTAATTAAAAAAAAATAGGG + Intergenic
1120344742 14:83271554-83271576 GGACTAATTAAAAAAAATTATGG - Intergenic
1123455975 15:20426425-20426447 AGTCAACTCAGACAAAAATAAGG - Intergenic
1123635595 15:22304412-22304434 AGTCAACTCAGACAAAAATAAGG + Intergenic
1127697664 15:61467631-61467653 GATCTAAATAGAGAAATATATGG + Intergenic
1128323900 15:66711118-66711140 GGTGTACTTATACTAAAATATGG - Intronic
1130753454 15:86738085-86738107 TGTCTATTGAGATAAAAATATGG + Intronic
1131994474 15:98120725-98120747 GCTCCAATTAGACAAAGACAGGG + Intergenic
1132070177 15:98769673-98769695 GGTTTAATTAGACCAGGATATGG + Intronic
1132181561 15:99757065-99757087 GGGCTCATTAGGCAAAAAGAGGG - Intergenic
1135841049 16:25876584-25876606 GTTCTAATTAGTCAAGAAAATGG + Intronic
1136503579 16:30687816-30687838 GGTCTTGTTAGAAAAAAAAAAGG - Intergenic
1144139016 17:12329087-12329109 GGGCTAATTAGCCAAAGAAAAGG - Intergenic
1144261181 17:13522680-13522702 AGTCAAATTAGACAAGAAAATGG + Intronic
1148995133 17:51702847-51702869 GGTCTAAAGAGACAAAAGGAAGG - Intronic
1149115726 17:53093795-53093817 GATCTAATAAGATTAAAATAGGG - Intergenic
1149307995 17:55367801-55367823 GGGATAATTAGAGAAAGATAAGG - Intergenic
1149678304 17:58486570-58486592 GGTATGATTAGACAAACATAAGG - Intronic
1153570582 18:6468332-6468354 GCTCAAATTAGACATAAATATGG - Intergenic
1156690251 18:39698745-39698767 GGTAAAATTAGGAAAAAATATGG + Intergenic
1158183636 18:54746287-54746309 GGTCGGATGAGACAAAAATCAGG + Intronic
1158849018 18:61475259-61475281 GGTCTAAGTAGCCAGATATAGGG + Intronic
1159166239 18:64704636-64704658 GTTCAGATTAGACAAAATTATGG - Intergenic
1159384780 18:67709545-67709567 GGTTTCATTAGAACAAAATAAGG + Intergenic
1160581159 18:79885321-79885343 GGTCTACTTGGCCAAAAATCAGG - Intronic
1163970518 19:20789301-20789323 GGTATAGTCAGACCAAAATAAGG - Intronic
1164299295 19:23947042-23947064 AATCTACTCAGACAAAAATAAGG - Intergenic
1165548749 19:36565042-36565064 GGTACAAATAGACATAAATATGG + Intronic
1167055472 19:47108735-47108757 GCTCTACTTAGAGAAAACTATGG + Intronic
1167753900 19:51398692-51398714 GGTCTATTTAGAGACACATAGGG + Intergenic
925332565 2:3070403-3070425 TGTCAACTTAGAGAAAAATAAGG - Intergenic
925810585 2:7696496-7696518 GTGCTAATTCGTCAAAAATAAGG + Intergenic
927765106 2:25799775-25799797 GCTTAAATTAGACAAAAATTGGG + Intronic
928414141 2:31077695-31077717 GGTTTAATTAGAGACAGATAAGG - Intronic
928824401 2:35402149-35402171 GCTATAATTAGCCATAAATAAGG + Intergenic
930375167 2:50556183-50556205 GGTCTAACTTTAGAAAAATAGGG - Intronic
932797088 2:74705382-74705404 GATCTAAGTATTCAAAAATAAGG + Intergenic
933033770 2:77366328-77366350 GGAATAACTAGAGAAAAATAGGG - Intronic
933353740 2:81189869-81189891 GAGGTAATTAGACACAAATAAGG - Intergenic
933540100 2:83629286-83629308 GCCTTAATTAGACAGAAATAAGG - Intergenic
935231900 2:101106217-101106239 GGTTAAATTAGTCAAACATAGGG + Intronic
935597644 2:104891855-104891877 TTTCTAAATATACAAAAATATGG + Intergenic
936727651 2:115340944-115340966 GATCTGATTAGACAAAATAATGG + Intronic
939591147 2:144065268-144065290 GGTCTAATGAGAAAAACATTTGG + Intronic
939666225 2:144954977-144954999 AGTCTAATTAGGCATAAATTTGG + Intergenic
939895061 2:147781788-147781810 GGTTGGATTAAACAAAAATAGGG - Intergenic
940088050 2:149883832-149883854 GGTCTAACAAGACAAAAATTGGG - Intergenic
940529731 2:154866102-154866124 TGTATAATAATACAAAAATATGG - Intergenic
940895604 2:159079878-159079900 TGTCTAAACAAACAAAAATAGGG - Intronic
944083500 2:195817183-195817205 GGGCTAACTAGAGAGAAATACGG + Intronic
945520303 2:210819279-210819301 GGTCTAACTAACAAAAAATAAGG - Intergenic
1174244099 20:49163299-49163321 GGTCTGACTAGAAAAAAAAAGGG - Intronic
1177593183 21:23200683-23200705 GGTAGAAATAGACAAAAAGATGG + Intergenic
1178400496 21:32280890-32280912 GGCCTACTAAGGCAAAAATAGGG - Intergenic
1179336414 21:40460380-40460402 GTTATTATTAGACAAAAATATGG + Intronic
949602552 3:5615815-5615837 GGTTTTATGAGCCAAAAATAGGG - Intergenic
951518821 3:23591933-23591955 GGTTTAATCAGCCAAAAGTAGGG - Intergenic
952264069 3:31768353-31768375 GGTCAGATTAGCCAAAAATTGGG - Intronic
953035621 3:39208089-39208111 TGTCTAAACAGCCAAAAATAGGG - Intergenic
955432393 3:58861337-58861359 AGTATAATTATACAAAGATAAGG + Intronic
956272542 3:67463121-67463143 GCTTTAATTAAAGAAAAATAGGG + Intronic
956302474 3:67787465-67787487 GGTATAATTATTAAAAAATAAGG - Intergenic
956327878 3:68073106-68073128 GTTCTAATTAACCAAGAATAAGG - Intronic
957388027 3:79522270-79522292 GGTCTGTTTAGATAATAATAGGG - Intronic
958972775 3:100631133-100631155 GTTCTAATCAGCCAAAATTATGG + Intronic
958979158 3:100700263-100700285 GATCTAAATAGACAATACTAGGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
967635916 3:191802662-191802684 AACCTAGTTAGACAAAAATAAGG + Intergenic
969363870 4:6682620-6682642 GGTCTCATTAGACACAGAAAAGG + Intergenic
970140829 4:12980202-12980224 TTTGTAATTAGGCAAAAATAGGG - Intergenic
970943473 4:21662560-21662582 GGCCTAAGTAGAAAGAAATAGGG - Intronic
973174091 4:47182685-47182707 GTTCAAATCAGACAAAAAAAGGG + Intronic
973559957 4:52125371-52125393 GGTCTAATGAGGCTAATATATGG + Intergenic
975051386 4:69869055-69869077 AGTCTAATTGGAAAAAAAAAAGG + Intergenic
975782959 4:77858940-77858962 TCTCTTATTAGACAAAAATAAGG - Intergenic
976400076 4:84597244-84597266 GTTCAAATTAAAAAAAAATAAGG + Intronic
978779209 4:112532358-112532380 AGTAGAATTAAACAAAAATAAGG + Intergenic
979810506 4:125030334-125030356 GATCTAAAAAGCCAAAAATATGG - Intergenic
981877724 4:149568373-149568395 TATTGAATTAGACAAAAATATGG - Intergenic
987698285 5:21360744-21360766 GTTTTAATAAGATAAAAATATGG + Intergenic
988754369 5:34230783-34230805 GTTTTAATAAGATAAAAATATGG - Intergenic
989425211 5:41289058-41289080 TTTCTAATTAGAAAAAAATCAGG - Intergenic
991468266 5:66937888-66937910 GGTATAATCATAAAAAAATATGG - Intronic
991742145 5:69691630-69691652 GTTTTAATAAGATAAAAATATGG - Intergenic
991755548 5:69863578-69863600 GTTTTAATAAGATAAAAATATGG + Intergenic
991793719 5:70271370-70271392 GTTTTAATAAGATAAAAATATGG - Intergenic
991821536 5:70566934-70566956 GTTTTAATAAGATAAAAATATGG - Intergenic
991834875 5:70738726-70738748 GTTTTAATAAGATAAAAATATGG + Intergenic
991886097 5:71270902-71270924 GTTTTAATAAGATAAAAATATGG - Intergenic
992561416 5:77956876-77956898 GGTATAATATAACAAAAATATGG - Intergenic
993134882 5:83947536-83947558 GGTAGAATTAGATAAAAACAGGG - Intronic
994399386 5:99260235-99260257 GGTCTGATGAGACAATAATTGGG + Intergenic
994828291 5:104744743-104744765 GGTATACATAGACACAAATATGG + Intergenic
995153088 5:108874276-108874298 GGTATAATGAGACCAAAATTAGG + Intronic
995595158 5:113739930-113739952 TGTCTAATTAAACAACTATAAGG - Intergenic
998938476 5:147255906-147255928 CGTCTATTTAGACACAATTAGGG - Intronic
1004816807 6:19319980-19320002 AGTCTAATTACACAAACACAGGG + Intergenic
1005552553 6:26937638-26937660 GTTTTAATAAGATAAAAATATGG - Intergenic
1008752610 6:54755204-54755226 GTTTTAATTAGGTAAAAATAGGG - Intergenic
1008784736 6:55153712-55153734 AGTCTAATTATTCAAAACTAGGG + Intronic
1009273919 6:61650607-61650629 GGCCTAATTAAAAAAAAAAAAGG - Intergenic
1009446408 6:63747704-63747726 GGTCAAAAAAGACAAAAAAAAGG - Intronic
1011540714 6:88425044-88425066 AGGCTAAGTAGACATAAATAAGG + Intergenic
1011890082 6:92147609-92147631 ACTCTAATTAGTAAAAAATAAGG - Intergenic
1012532646 6:100256580-100256602 TTTATAATTAGAAAAAAATAAGG - Intergenic
1012624117 6:101385540-101385562 GTTCTAAATAGACAAGAATTTGG + Intergenic
1014085887 6:117343272-117343294 GGGTTAATTAGACAAAATTAAGG + Intronic
1014668246 6:124266774-124266796 GGTCTATTCAGATAAAGATATGG + Intronic
1018154268 6:160970929-160970951 GGTCTAATGAGCAAAGAATATGG + Intergenic
1022900823 7:34809209-34809231 CGTCTACTTAGACAAAACTGGGG - Intronic
1023017145 7:35979873-35979895 GGTCTAATTAGGCACTAATGAGG - Intergenic
1023706613 7:42947837-42947859 TGTCTAAATAGACAAAAGTCTGG + Intronic
1024320436 7:48061668-48061690 GGTCAAGGAAGACAAAAATAGGG + Intergenic
1025153626 7:56583169-56583191 GGTCTACTCAGACAGAAATCAGG - Intergenic
1025763662 7:64419710-64419732 AATCTACTCAGACAAAAATAAGG + Intergenic
1026429945 7:70335352-70335374 GGACTAATTAGACAAGAGTAGGG - Intronic
1026433536 7:70372356-70372378 GTTCCATTAAGACAAAAATACGG - Intronic
1027770247 7:82397890-82397912 GCTCTTATTAGACAATAAAAGGG + Intronic
1029860660 7:103568154-103568176 GTTCTAGTTAGTCAAGAATAGGG - Intronic
1030538155 7:110794697-110794719 GGTTTACTTAGAAGAAAATAAGG + Intronic
1030759192 7:113330138-113330160 TGTCTAGTTAGAAAAAAAAAAGG - Intergenic
1031367375 7:120918931-120918953 GGTCCAATTAGACATAAATATGG + Intergenic
1031938613 7:127763054-127763076 AGTCTAAATAGCCAGAAATAGGG + Intronic
1035830010 8:2685451-2685473 GAGATAATTCGACAAAAATATGG + Intergenic
1038171049 8:25132660-25132682 GGTATAATTATACAAAAAACCGG - Intergenic
1040786759 8:51175956-51175978 AGTCTAATGAGAAAAATATAAGG - Intergenic
1041420182 8:57659305-57659327 GGTCTAATAAGTCAAACATCTGG + Intergenic
1045487022 8:102639766-102639788 GGGATAATTAGAGAAAAAAATGG + Intergenic
1045683440 8:104687141-104687163 GGTCTAATTAGACTTTTATAAGG - Intronic
1046936023 8:119886847-119886869 GGTATCATTTGCCAAAAATAGGG - Intronic
1047244786 8:123131958-123131980 AGTCTAACTTGACAAAAAGATGG - Intronic
1048113511 8:131493693-131493715 AGTGTGATAAGACAAAAATAAGG + Intergenic
1048164078 8:132046580-132046602 GGGCTAATGGGACAAATATATGG + Intronic
1050868425 9:10534618-10534640 GGACGAATTAAACAAAAATTTGG - Intronic
1052664679 9:31479764-31479786 GGTATACATAGACATAAATATGG - Intergenic
1052746154 9:32443167-32443189 GGTGTTATGAGGCAAAAATAAGG + Intronic
1053372383 9:37573697-37573719 AGTCTACTTAGAAAAAAATAAGG + Intronic
1054991308 9:71330185-71330207 GCTCTAATTAGCCAAGATTAGGG - Intronic
1055345204 9:75328097-75328119 GATCTAATTAGAGAAATATGTGG - Intergenic
1055614882 9:78061470-78061492 GGTCCAATTAGAAGTAAATATGG + Intergenic
1056038876 9:82638782-82638804 AATCTAGTTAGACTAAAATAAGG + Intergenic
1056180175 9:84075408-84075430 TGCCTAAAAAGACAAAAATAGGG - Intergenic
1058413267 9:104758125-104758147 AGTCTAAATAGTCAACAATAAGG + Intronic
1058478678 9:105368645-105368667 GGTGTAAGCAAACAAAAATATGG + Intronic
1059084991 9:111291175-111291197 AGGCTAAGTAGACAAAAATAAGG - Intergenic
1187990989 X:24872097-24872119 GTTGTAATTAGACCAAAAAAAGG + Intronic
1188730783 X:33643641-33643663 GGTCTATATAGACATCAATATGG - Intergenic
1189063078 X:37775379-37775401 GATATAATTAGGCAAAAATTGGG + Intronic
1189455784 X:41188007-41188029 GCTCTAATTACACAAATATCAGG - Exonic
1192285387 X:69729560-69729582 TGTGTAATTAGAATAAAATAGGG - Intronic
1193710213 X:84870449-84870471 GATCTAATTAAACTAAAATGTGG + Intergenic
1194669572 X:96714111-96714133 AGTCTAATTAGAAAAAAAAGTGG - Intronic
1196710043 X:118753206-118753228 GTTCTTCTAAGACAAAAATAGGG + Intronic
1196907298 X:120450059-120450081 GGACTAGTAAAACAAAAATAAGG - Intronic
1197113451 X:122803256-122803278 GGTATAATAAGATAATAATAGGG + Intergenic
1198804759 X:140483083-140483105 GTTCTGTTTAGACAAAAATCTGG + Intergenic