ID: 1114317957

View in Genome Browser
Species Human (GRCh38)
Location 14:21524849-21524871
Sequence CTTTCTCTGCTGGAGGGGTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 272}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114317957_1114317967 6 Left 1114317957 14:21524849-21524871 CCCAACCCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 44
4: 272
Right 1114317967 14:21524878-21524900 GTGACCCCAGTGGGTGGTAAAGG 0: 1
1: 0
2: 0
3: 11
4: 146
1114317957_1114317973 25 Left 1114317957 14:21524849-21524871 CCCAACCCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 44
4: 272
Right 1114317973 14:21524897-21524919 AAGGTGGAAGAAGGCCTGCTTGG 0: 1
1: 0
2: 0
3: 34
4: 257
1114317957_1114317965 -3 Left 1114317957 14:21524849-21524871 CCCAACCCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 44
4: 272
Right 1114317965 14:21524869-21524891 AAGGATGCTGTGACCCCAGTGGG 0: 1
1: 0
2: 1
3: 25
4: 525
1114317957_1114317968 9 Left 1114317957 14:21524849-21524871 CCCAACCCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 44
4: 272
Right 1114317968 14:21524881-21524903 ACCCCAGTGGGTGGTAAAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 142
1114317957_1114317964 -4 Left 1114317957 14:21524849-21524871 CCCAACCCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 44
4: 272
Right 1114317964 14:21524868-21524890 AAAGGATGCTGTGACCCCAGTGG 0: 1
1: 0
2: 3
3: 27
4: 236
1114317957_1114317972 16 Left 1114317957 14:21524849-21524871 CCCAACCCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 44
4: 272
Right 1114317972 14:21524888-21524910 TGGGTGGTAAAGGTGGAAGAAGG 0: 1
1: 0
2: 4
3: 46
4: 403
1114317957_1114317974 26 Left 1114317957 14:21524849-21524871 CCCAACCCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 44
4: 272
Right 1114317974 14:21524898-21524920 AGGTGGAAGAAGGCCTGCTTGGG 0: 1
1: 0
2: 2
3: 27
4: 246
1114317957_1114317966 0 Left 1114317957 14:21524849-21524871 CCCAACCCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 44
4: 272
Right 1114317966 14:21524872-21524894 GATGCTGTGACCCCAGTGGGTGG 0: 1
1: 0
2: 0
3: 25
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114317957 Original CRISPR CTTTCTCTGCTGGAGGGGTT GGG (reversed) Exonic
900321772 1:2088054-2088076 CTTTCTCTGCTGTGTGGGTGGGG + Intronic
902142913 1:14371414-14371436 CTATCTCAGCTGCAGGGGGTGGG - Intergenic
902488813 1:16765698-16765720 CCTTCTCTCCTGGATGGGTTGGG - Intronic
907294019 1:53438372-53438394 CTTTTTCTTCTTCAGGGGTTCGG + Intergenic
907978083 1:59453077-59453099 CTTTCCCTCCTGGAGAGTTTTGG + Intronic
908433768 1:64084743-64084765 CTTTGTCTGTTGAAGGAGTTTGG - Intronic
911176321 1:94821035-94821057 CTTTCTCTTTTGGACTGGTTTGG + Exonic
911549443 1:99262112-99262134 CTTTGTCTTGTGGAGGGGGTGGG - Intergenic
912841313 1:113041947-113041969 CCATCTCTGCTGGAGGGGAAAGG + Intergenic
913230675 1:116738332-116738354 CTTTCTCAGCTGTTGGGCTTGGG - Intergenic
913527560 1:119708755-119708777 TTTTCTCTTCTGAAGGGGTTGGG + Intronic
915958117 1:160240229-160240251 CTTTCTGTGCTGGTGCGGTTGGG + Exonic
915977071 1:160398557-160398579 CTTTCTCTGACGGTGAGGTTGGG - Intergenic
918243647 1:182640971-182640993 CACTCTCTCCTGGAGGGGTCAGG + Intergenic
920208117 1:204307838-204307860 CTTGAACTGCTGGAGGGGTTGGG - Intronic
922334708 1:224609373-224609395 GTTTCTCTCTTGGTGGGGTTTGG - Intronic
922968139 1:229709879-229709901 CTTTCCCTGTTGGAGGCCTTTGG + Intergenic
923531623 1:234816826-234816848 CCTTCTCTCCTGGATGGGTTGGG + Intergenic
923574739 1:235147989-235148011 CGTTCTCTGTTTGAGGGTTTTGG - Intronic
1062829107 10:593556-593578 CTGCCTCTGCTGGAGAGGGTTGG - Intronic
1062836275 10:637985-638007 GTTTCCCTGGTGGAGGGATTAGG - Intronic
1066271715 10:33830513-33830535 TTTTCTCTAATGAAGGGGTTGGG + Intergenic
1067220921 10:44343794-44343816 CTTCCTCTGCAGTAGGGCTTGGG - Intergenic
1067275621 10:44830637-44830659 CTTTTTCTGGTGGAGGGTCTAGG + Intergenic
1068781266 10:60921353-60921375 CTTTCTCTCCTGGAGAACTTAGG - Intronic
1069680641 10:70282992-70283014 CTTTGTCTGCTTGAAGGGGTGGG - Intronic
1069890909 10:71651993-71652015 CTATCCCTGCTGCAGGGGGTGGG + Intronic
1070229586 10:74550527-74550549 CTATCACTGCTGGAGGGGAGAGG - Intronic
1070464974 10:76712084-76712106 CTTGCTCTGGTGGAGGTGGTGGG - Intergenic
1070827570 10:79400038-79400060 CTTTACCAGCTGCAGGGGTTGGG - Intronic
1073287254 10:102396392-102396414 CTCTCTCTGGGGGAGGGGCTGGG + Intronic
1074072760 10:110089445-110089467 CTTTCTCTAAGGAAGGGGTTGGG + Intronic
1074122401 10:110502400-110502422 CTTTGTTTTCTGGAGGGATTTGG + Intronic
1075281021 10:121138507-121138529 ATTTCTCTGCTGATGGTGTTTGG - Intergenic
1075627432 10:123972859-123972881 CTGTCTCTGCTGGAATGGGTGGG + Intergenic
1077509718 11:2951704-2951726 CTTTCTCTGCTTGAAGGTTATGG - Intronic
1078016224 11:7617339-7617361 ATTTCACTGGTGGAGGGGCTGGG + Intronic
1078324507 11:10368820-10368842 ATTTCTATGTTGGAGGGGTTAGG + Intronic
1078407191 11:11080694-11080716 CTCTTTCTGCTGGTGGGATTTGG + Intergenic
1079323663 11:19473336-19473358 CATACTCTGCAGGAGGGGGTGGG + Intronic
1080599833 11:33810443-33810465 CTTTCTCTGCTGGATTGGCTGGG - Intergenic
1081754083 11:45532311-45532333 CTTTCTCTGATGGCTGGGATGGG - Intergenic
1082152584 11:48760897-48760919 CTTTCTTTGATTGAGGAGTTTGG - Intergenic
1082601708 11:55166475-55166497 CTTTCTTTGATTGAGGAGTTTGG - Intergenic
1083425294 11:62581294-62581316 CTTCCTCCGCTAGAGGTGTTTGG - Intronic
1084747524 11:71182705-71182727 CATTCTCAGGTCGAGGGGTTAGG + Intronic
1086824271 11:91475831-91475853 CCTGCTGTGCTGGAGGGGCTGGG - Intergenic
1093401740 12:18754313-18754335 CTCTCTCTGCCGGCTGGGTTTGG + Intergenic
1094246947 12:28309069-28309091 CTTTGCCTGTTGGAGGGGTATGG + Intronic
1094541879 12:31369543-31369565 TTTATACTGCTGGAGGGGTTCGG + Intergenic
1094862961 12:34491049-34491071 CTTTCCCTGATGGAGCAGTTGGG - Intergenic
1094869159 12:34579196-34579218 CTTTCTTTGATGGAGTAGTTTGG - Intergenic
1094886184 12:34876130-34876152 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094887654 12:34899898-34899920 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094898563 12:35077559-35077581 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094898828 12:35081637-35081659 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094900804 12:35113567-35113589 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094908174 12:35232444-35232466 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094910765 12:35274226-35274248 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094912855 12:35308190-35308212 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094931784 12:35614739-35614761 CTTTCTTTGATGGCGGAGTTTGG + Intergenic
1094935896 12:35681616-35681638 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094938851 12:35729514-35729536 CTTTCTTTGATGGAGCAGTTTGG + Intergenic
1094943144 12:35799149-35799171 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094946592 12:35854857-35854879 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094955188 12:35994138-35994160 CTTTCTTTGATGGCGGAGTTTGG + Intergenic
1094961149 12:36090608-36090630 CTTTCTTTGATGGCGGAGTTTGG + Intergenic
1094970499 12:36241443-36241465 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094986127 12:36493868-36493890 CTTTCTTTGATGGCGGAGTTTGG + Intergenic
1094994734 12:36633146-36633168 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1094998794 12:36698562-36698584 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1095007901 12:36846545-36846567 CTTTCTTTGATGGAGCAGTTTGG + Intergenic
1095019046 12:37027015-37027037 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1095022597 12:37084422-37084444 CTTTCTTTGATGGAAGAGTTTGG + Intergenic
1095028494 12:37179532-37179554 CTTTCTTTGATGGAGGAGTTTGG + Intergenic
1095079531 12:37982126-37982148 CTTTCTTTGATGGAGCAGTTTGG + Intergenic
1096571103 12:52523818-52523840 CTTTCTCTCCTGGAGGGGCCTGG - Intergenic
1098467030 12:70799077-70799099 CTTTCTCTGATTGAGGGGTTTGG - Intronic
1099212135 12:79804179-79804201 CTTTTTTTGGTGGTGGGGTTGGG - Intronic
1099921589 12:88964101-88964123 CTTTTACTTCTGGAGGGGTCTGG + Intergenic
1101896227 12:108759016-108759038 CTTTCTCTGCTGCCCGGCTTTGG + Intergenic
1102081663 12:110103250-110103272 CTTTCTCTACTGCAGGGCTTGGG + Intergenic
1104182243 12:126393445-126393467 CTCTACCTGATGGAGGGGTTGGG - Intergenic
1104440137 12:128787464-128787486 TTTTCTCTGCTCGGGGAGTTTGG + Intergenic
1106428304 13:29655058-29655080 CTTTTTCTGCAGTAGGGCTTGGG + Intergenic
1106608900 13:31259276-31259298 CTTGCTCTGCTGGGTGAGTTTGG + Intronic
1107957093 13:45525611-45525633 TTTTTTGTGCTGGAGGGCTTTGG + Intronic
1108055007 13:46476860-46476882 CCTTCTTTGGTGGAGGGGATGGG + Intergenic
1109168777 13:59069976-59069998 TTTTCTCTGCTAGGGGCGTTTGG + Intergenic
1110713170 13:78672270-78672292 CTCTCTCTGTTGGAGTGGGTTGG + Intergenic
1114317957 14:21524849-21524871 CTTTCTCTGCTGGAGGGGTTGGG - Exonic
1114423701 14:22604981-22605003 CTCTCCCTGCTGCAGGTGTTGGG - Intronic
1114568165 14:23647477-23647499 CTTTCTCTACTGCAGGGCCTGGG - Intergenic
1114879967 14:26772456-26772478 CTTGCTCTTCTGGAGTGGCTTGG + Intergenic
1115786327 14:36829764-36829786 CAGCCTCTGCTGAAGGGGTTGGG - Intronic
1116940358 14:50785011-50785033 TTTTGTCTGCCTGAGGGGTTGGG - Intronic
1117155238 14:52933080-52933102 CTTACTTTGCTGGATGGGGTGGG - Intronic
1117956167 14:61125278-61125300 TATTCTCTGCTGGAGGGATGGGG - Intergenic
1117995067 14:61470539-61470561 CCTTTTTTGCTGGAGGGCTTTGG + Intronic
1118005813 14:61563407-61563429 CCCTCTCTGCTGGAGGGCTCTGG - Intronic
1119760832 14:77150604-77150626 CTCTCTCTGCTGGAGGGCAGTGG + Intronic
1119809552 14:77505350-77505372 CTTTCTCTTATGCAGGGGGTGGG - Intergenic
1120967925 14:90184096-90184118 TTTTCTCTCCTGCAGGGTTTGGG + Exonic
1122093837 14:99357125-99357147 CTTTCCCTCCTTGAGGGGTTTGG - Intergenic
1122919508 14:104874261-104874283 CAGTCTCTGCCGGAGGGGTTGGG - Intronic
1124202503 15:27690519-27690541 CCGTCTCTTCTGGAGGAGTTAGG - Intergenic
1124871840 15:33551462-33551484 CCTTCTTTGGTGCAGGGGTTCGG + Intronic
1125069503 15:35535059-35535081 CTTTCTCTGATTGATGGTTTGGG - Intronic
1125756107 15:42066083-42066105 CTTTGTTTGCTGGGGGGCTTTGG - Intergenic
1127586610 15:60383716-60383738 CATTATGTGCTGGGGGGGTTGGG - Intronic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1137353062 16:47731411-47731433 CTTTCTCAGCTGCTGGGGTTTGG + Intergenic
1138298933 16:55910356-55910378 CTTTATCTGCTGGAGAGGACTGG - Intronic
1139168682 16:64603280-64603302 CTACCTTTGCTGGTGGGGTTAGG - Intergenic
1143166182 17:4898295-4898317 CTGGCTCTGCTGGAGCGGGTGGG - Exonic
1143561173 17:7696075-7696097 CTTGCTTAGCTGGAGGGGTTAGG + Intronic
1143827954 17:9628136-9628158 CTTTCTCTTTAGGAAGGGTTGGG - Intronic
1146057996 17:29590563-29590585 CTTTTGCTGCTGCAGGGATTGGG - Intronic
1147165828 17:38592816-38592838 CTTTTTTTGTTGGGGGGGTTGGG + Intronic
1148565840 17:48632453-48632475 CTTGCTTAGCTGGAGGAGTTGGG - Intronic
1148619361 17:49022728-49022750 CTTTCTTTCGTGGAGGGGATGGG - Intronic
1148644285 17:49210449-49210471 CTTCCTCTGCTGGGTGGGATTGG + Exonic
1149431201 17:56596420-56596442 CTTTCTCCCCTTGAGGGGTGGGG + Intergenic
1151918175 17:77134079-77134101 CTTTCTCTGCTGCAGCGCTGCGG + Intronic
1152118274 17:78402109-78402131 CTTTCTCCCCTGGAGGGTGTTGG + Intronic
1153927529 18:9847202-9847224 CATTCTCTTCTGGTGGCGTTAGG + Intronic
1158311937 18:56168465-56168487 CTTTCCCTTCTGGATGTGTTTGG - Intergenic
1159341901 18:67145739-67145761 TTTTGTCTGCTGCAGGAGTTAGG + Intergenic
1159568434 18:70083398-70083420 CTTTCTCTGTGGTAGGGGTTGGG + Intronic
1160521158 18:79508973-79508995 TTTTCTCTGCTGGAGTGGACAGG + Intronic
1162863489 19:13525890-13525912 TTTTCACTTCTGGAGGTGTTGGG - Intronic
1162879342 19:13646581-13646603 CTCTCTATGGGGGAGGGGTTAGG - Intergenic
1163189136 19:15663442-15663464 CACTCTCTGCTGGACGGTTTGGG + Intergenic
1165170327 19:33887704-33887726 TTTTCTCAGCTGGTGGGGGTTGG - Intergenic
1165798791 19:38535127-38535149 CTGTCTCTCCTGGAGGGAGTGGG - Exonic
1168041721 19:53764262-53764284 CTTTCTCTGCAGGAAGGGTGTGG + Intergenic
1168401096 19:56086810-56086832 CTGTCTCTGCTGCAGGGGCCAGG - Intergenic
1168703473 19:58455033-58455055 CTGGCTCTGCAGGAGGGGCTGGG - Intronic
925281153 2:2686162-2686184 CATTCTCTACTGGGGGGATTAGG + Intergenic
926223091 2:10948961-10948983 CTGTCTTGGCTGGAGGAGTTGGG + Intergenic
927199708 2:20570790-20570812 CTCTCTGAGCTGGAGGAGTTTGG + Intronic
932702961 2:74003373-74003395 CTTTCTCAGCTGGATGGTTTTGG + Intronic
933616175 2:84484492-84484514 CTTTCTCTACTGGAGGTTGTGGG + Intergenic
933701179 2:85256376-85256398 CTTTCTCTGTTGGAGGATTTGGG + Intronic
934477587 2:94603618-94603640 GTCTCTCTGCTGGTGGGCTTGGG + Intronic
935800655 2:106691848-106691870 CTTTGTCCACTGGAGGGATTTGG + Intergenic
936265060 2:110998323-110998345 CTTTGTCTGCTGCAGTGATTTGG - Intronic
936947629 2:117944895-117944917 CTCTTTCTTCTGGAGGGTTTTGG + Intronic
937466823 2:122140034-122140056 CTTGATCAGCTGGAAGGGTTTGG + Intergenic
937924574 2:127157933-127157955 CTTGCTCTGCTGCAGAGTTTTGG - Intergenic
938094221 2:128451195-128451217 GTGTCCCTGCTGGAGGGGCTGGG + Intergenic
938728075 2:134124248-134124270 CGTTCTCAGCTAGAGGAGTTTGG + Intronic
938927201 2:136054964-136054986 CTTCCTCTTCTGGGTGGGTTGGG + Intergenic
939896386 2:147796541-147796563 CTTACTCTGCAGGTGGGGGTGGG - Intergenic
942719184 2:178930685-178930707 CTTTCTCTGTTGAAGGACTTTGG - Intronic
942970697 2:181954357-181954379 ACTTCACTGCTGGAGGGGGTCGG - Intronic
942975974 2:182018219-182018241 GTTTCTATGCTGGATGTGTTAGG + Intronic
943521227 2:188951281-188951303 TTTTCTGTGGTGGAGGGGATTGG - Intergenic
944047323 2:195428098-195428120 CTTGCTGTGCTGGACAGGTTTGG - Intergenic
944264074 2:197705457-197705479 CTGTCTCTCCTGGAGGACTTCGG + Exonic
946087881 2:217192682-217192704 CACTCTCTACTGCAGGGGTTGGG - Intergenic
947530861 2:230907924-230907946 CTTTCTCTGCACGAGGAGTTGGG - Exonic
948918495 2:241050629-241050651 CTACCTCTGCTGCAGTGGTTGGG - Intronic
1171516424 20:25741748-25741770 CTTTCTTGGCTGGAGGTCTTGGG + Intergenic
1172137553 20:32697472-32697494 ATTCCTCTGCTTCAGGGGTTAGG - Intergenic
1172216662 20:33240369-33240391 ATTTCTCTGCTTGATGGGTGAGG + Exonic
1172250820 20:33477917-33477939 TTTTCTCTGCTGGTGGTGTTGGG - Intergenic
1172261328 20:33568489-33568511 CTTACTCTGCTGGAAGAGCTGGG + Intronic
1172359509 20:34302682-34302704 CTGCCCCTGCTGGAGGGGTGGGG + Intronic
1172818098 20:37705951-37705973 CTTGCTTTACTGGAGTGGTTTGG - Intronic
1173033946 20:39390610-39390632 CTCTCTCTGGTGGAGGGATTTGG + Intergenic
1173461977 20:43250172-43250194 CTTCCTCTGCTGGTGGTGCTAGG - Intergenic
1173931750 20:46826641-46826663 CTCTTTCCACTGGAGGGGTTAGG + Intergenic
1174910304 20:54600872-54600894 TTCTCTATGCTGGAGGTGTTAGG + Intronic
1175264425 20:57693966-57693988 CTTTCTCTGCCGGTGAGGATGGG + Intronic
1175321615 20:58092231-58092253 CATTCACAGCTGCAGGGGTTAGG - Intergenic
1175996318 20:62813682-62813704 CTGTCCCTGCTGCAGGGGCTGGG + Exonic
1177108482 21:16992536-16992558 CCTTCTCTGATGGCGGGGGTGGG + Intergenic
1177668252 21:24189943-24189965 CTTTCTCTGTTGGATGCTTTAGG - Intergenic
1178724163 21:35036470-35036492 CTTCCCTTTCTGGAGGGGTTCGG - Intronic
1178934659 21:36850926-36850948 CTACCCCTGCTGGAGGGGTGAGG + Intronic
1179983954 21:44910888-44910910 CTGTCCCTGCTGCAGGGGGTGGG + Intronic
1182829391 22:33292424-33292446 CTTTCTATACTGGGGGGTTTGGG + Intronic
1183372409 22:37441294-37441316 ATCTGTCTGCTGCAGGGGTTGGG - Intergenic
1185077261 22:48690119-48690141 CTTTCCATGCAGGAGGGGTGGGG - Intronic
950023234 3:9803445-9803467 CTTTTTCTGCTGGAGGGCTGTGG - Intronic
951159938 3:19407337-19407359 ATTTATCTGCTAGAGGGATTTGG + Intronic
952285850 3:31969289-31969311 CTTTCTCTGCCTGAGTGTTTAGG - Intronic
953832587 3:46313239-46313261 GTTGCTCTGCTGGAGGAGTATGG - Intergenic
954901567 3:54024629-54024651 CTTTCCTTGCAGGAGGGCTTGGG + Intergenic
954969911 3:54642909-54642931 ATTTTGCTGCTGGAGGGGTGGGG - Intronic
955754077 3:62210286-62210308 ATTTCTCTGCAGCAGTGGTTTGG + Intronic
956267833 3:67417709-67417731 CTTTCTCTGCTGGAGGAAAAGGG - Intronic
956531525 3:70224836-70224858 CTTTCTTTGTTGGATGGGTGAGG - Intergenic
956694178 3:71904574-71904596 CCTTCCCTGCTGGAAGGGTCAGG + Intergenic
957254932 3:77824950-77824972 TTTTCTCTTCTGTAGGGGGTGGG + Intergenic
957823413 3:85408673-85408695 CTCTCTCTGCAGCGGGGGTTAGG + Intronic
960634480 3:119769361-119769383 CCTTTCTTGCTGGAGGGGTTAGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961478801 3:127166284-127166306 CTTACTGTGCTGGAGGGTTGAGG + Intergenic
961595181 3:128010141-128010163 CTGGCTCTGCTGGTGGGGTGTGG + Intergenic
964324991 3:155535600-155535622 CTGTCGCTGCTGTAGGGGCTGGG - Intronic
965075664 3:163972125-163972147 CTTTCTCAGCAGGAGGTCTTAGG - Intergenic
966259208 3:177955463-177955485 TTTTCAGTGCTGGAGGGGTGAGG - Intergenic
967144134 3:186591693-186591715 CTTTCTCTGCTGGGGTGCCTGGG + Intronic
967666595 3:192180128-192180150 CTTTCTCTGGTAGAGGAATTTGG + Intronic
968037975 3:195564375-195564397 CTTATTCTGCTGGAAGTGTTAGG + Intergenic
968251522 3:197220657-197220679 CTTTTTCTGCTGGATAGGTGGGG - Intronic
968465933 4:751097-751119 CTTTCTCTGCTCTAATGGTTTGG + Intronic
968973833 4:3810894-3810916 CTGCCTCTGCTGGAGGCCTTGGG + Intergenic
969237318 4:5874850-5874872 CTCTCTCAGCTAGTGGGGTTAGG - Intronic
969260181 4:6028405-6028427 CCATCTCTGCTGGAGGTGTAGGG - Intronic
970507111 4:16742929-16742951 CATTTCCTGCTGTAGGGGTTGGG - Intronic
972924964 4:43992794-43992816 CATTCTCTGCTGGAGCGTTTGGG - Intergenic
974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG + Intergenic
975254186 4:72215077-72215099 CATTTTCTTCTGGAAGGGTTTGG - Intergenic
975422700 4:74187281-74187303 CATTCTATTCTGGAGCGGTTTGG - Intronic
976271063 4:83230750-83230772 TTTTCTCTGGTGGTGGGGTGTGG + Intergenic
977660507 4:99579745-99579767 CTTTGTCTGCTGGTTGGGTGCGG + Intronic
978745986 4:112194890-112194912 CTGTCTCAGCAGGAGTGGTTGGG + Exonic
980038083 4:127907664-127907686 TTTTCTCTGGGGGAGGGGTATGG + Intergenic
982619128 4:157680911-157680933 ATTTCTGTGCTGGCAGGGTTAGG + Intergenic
985812447 5:2099646-2099668 CTTTCTATGCAGGAGGAGTGGGG - Intergenic
986413190 5:7502370-7502392 CTCTCTGGACTGGAGGGGTTTGG - Intronic
988428664 5:31093449-31093471 CTCTTTCTTCTGGAGGGTTTAGG + Intergenic
988988139 5:36641109-36641131 CTCTGTCTGCAGGAGGGTTTTGG - Intronic
989581600 5:43038584-43038606 CTCGCTCTGCTGGAGGGCGTTGG + Intergenic
989835671 5:45986720-45986742 GTTTCTTTGATGGAGAGGTTTGG + Intergenic
989835906 5:45990724-45990746 CTTTCTTTGATGGAGCAGTTTGG + Intergenic
990527080 5:56638643-56638665 CTTTCTCAGGTGGAGCAGTTAGG - Intergenic
990936189 5:61152193-61152215 CTTTCTCTTCTGGAGTGGTATGG - Intronic
991066942 5:62433900-62433922 ATTTCTTTGGTGGAGGGGGTGGG + Intronic
992170150 5:74093355-74093377 CTTTCTCTGCTGCAGCTGCTGGG + Intergenic
993308877 5:86303317-86303339 CTTTCTCTACTGCAGGCTTTTGG - Intergenic
993829333 5:92734274-92734296 TTTACTCTGCTGGAGGAATTAGG + Intergenic
993838534 5:92846720-92846742 CTTTTTCTGCAGGGGGGGTGGGG - Intergenic
994188095 5:96838010-96838032 CTCTCTCTGCTGGTGGAGCTTGG + Intronic
996353167 5:122568108-122568130 CTTTCTCTGGTGGAAGAATTGGG - Intergenic
998224759 5:140318380-140318402 CTCTCTTTGCTGAAGGGGGTGGG - Intergenic
998491868 5:142553970-142553992 CTTTATTTTCTGGAGGGGTCTGG + Intergenic
999109455 5:149105712-149105734 CTTCCCTTGATGGAGGGGTTAGG - Intergenic
999859044 5:155625426-155625448 CTTTTTCTGTTGGAGTGGTGTGG + Intergenic
1001132424 5:169075397-169075419 CTTTCTCTGCTGGTGTGTTTTGG + Intronic
1001255124 5:170177385-170177407 CTTTCTGTGCTGGGGAGGTGAGG - Intergenic
1001313389 5:170626774-170626796 ATTTGTCTTCTGGAGGGGATTGG + Intronic
1001825615 5:174742809-174742831 CCTGCTCTCCTGGAGGGGTTGGG - Intergenic
1001901334 5:175432745-175432767 GTTGCTTTGCTGGCGGGGTTGGG - Intergenic
1002616857 5:180461485-180461507 CGTTCTCTGCTGGCGAGCTTAGG - Intergenic
1003128439 6:3374701-3374723 CTTGCTCTGCTTCAGGGCTTCGG - Intronic
1003571709 6:7260607-7260629 TTTTCTGTGCAGGAGGGGTGGGG - Intergenic
1004801949 6:19158035-19158057 ATTTCTCTACAGGAGGGATTTGG + Intergenic
1005064812 6:21807822-21807844 CTTTCTCTTCTGGAGTGGGAAGG - Intergenic
1006037189 6:31222993-31223015 CAGGCTCTGCTGGAGGGGGTGGG + Intergenic
1007180812 6:39927856-39927878 TTCTCTCTGCAGGACGGGTTTGG - Intronic
1013851722 6:114523966-114523988 CTTCCTCTGCGGCAGGGTTTCGG + Intergenic
1014801877 6:125787633-125787655 CTTTCTCTGTTGAAGGGTATGGG - Intronic
1015125448 6:129749191-129749213 TTTTCTCTAATGGAGGTGTTGGG - Intergenic
1015244382 6:131061668-131061690 GTTTCTATGCTGCAGGGGCTAGG - Intronic
1015561183 6:134517729-134517751 CTTTGTCTGTGGGAGGGGTGAGG - Intergenic
1017630995 6:156396567-156396589 CTTTCTCTAAAGGAGGGGTAGGG + Intergenic
1018017714 6:159727267-159727289 TTTCCTCTCCTGGCGGGGTTCGG + Exonic
1018873586 6:167801580-167801602 ATTTCTTTCCTGGTGGGGTTGGG - Intergenic
1018964582 6:168474469-168474491 CTCTCTCTGCTGGTGTGGTCTGG + Intronic
1019168956 6:170117807-170117829 CTTTCTCTGGAGAAGGGGTCAGG - Intergenic
1020286926 7:6689550-6689572 CTTACTCTGCTGGCGGAGTTTGG - Exonic
1021204030 7:17757880-17757902 TTTTCTCTGGTGGAAAGGTTTGG + Intergenic
1021307064 7:19045478-19045500 CATTCTCTGCTGGAGTGGGTGGG - Intronic
1022106814 7:27202530-27202552 CTTTCTCTGCGCGCAGGGTTCGG - Intergenic
1023086351 7:36573362-36573384 GATTCTCTGGTGCAGGGGTTAGG - Intronic
1023116107 7:36864249-36864271 CTTTCTCTTCTGCAGGGGGATGG + Intronic
1023168479 7:37366760-37366782 CTTTCTCCGTTAGAGGAGTTCGG - Intronic
1023498689 7:40825576-40825598 CTTACTCATGTGGAGGGGTTAGG - Intronic
1024555669 7:50601237-50601259 GTTTATCTGGTGTAGGGGTTGGG + Intronic
1024854618 7:53763767-53763789 CTTTCTTTTCTGGGGGGGTTGGG + Intergenic
1025552994 7:62272902-62272924 CTTTCTCTGCTGAAGGCTTAAGG + Intergenic
1026394459 7:69937294-69937316 ATTTATCTGGGGGAGGGGTTTGG + Intronic
1026916273 7:74121849-74121871 CTCTCTCTGCTTTGGGGGTTTGG - Exonic
1027225972 7:76243888-76243910 CTGCCTCTGCTGGGGGGGTGGGG + Intronic
1028071138 7:86452263-86452285 CATTGTTTGCTGGAGGGATTGGG + Intergenic
1028393833 7:90345964-90345986 TTTTCGCTGCATGAGGGGTTGGG + Intronic
1028774680 7:94663763-94663785 CTTCCTCTATTGGAGGGGGTGGG - Exonic
1031083895 7:117283409-117283431 CTTTATCTGCCGTAGGGCTTTGG + Intronic
1032586393 7:133151105-133151127 CCTTCACTTCTGCAGGGGTTTGG + Intergenic
1032887906 7:136162218-136162240 CTTTCTCTGCATTAGGGATTGGG + Intergenic
1033281813 7:140011378-140011400 CTTTCTCTTCTCTAGGGGATGGG - Intronic
1033638579 7:143237833-143237855 CCTCTACTGCTGGAGGGGTTGGG + Intergenic
1037047491 8:14326311-14326333 CTTTCTCTTTTGGAGGGGTTAGG - Intronic
1037309570 8:17540496-17540518 TTTTCTTTTTTGGAGGGGTTGGG - Intronic
1038779816 8:30560458-30560480 CTTTCTCTGATGGCAGGGATAGG + Intronic
1040951648 8:52942870-52942892 CTCTCTCTGCTGGCCGGCTTCGG + Intergenic
1044707639 8:95024445-95024467 GCTTTTCTGCTGGAGGTGTTAGG + Intronic
1050535896 9:6630580-6630602 CTTTCTCTGCTAGAGGGTAAGGG + Intronic
1052852379 9:33385938-33385960 GTGTCTCTGCTGGTGGGCTTGGG - Intronic
1053680478 9:40482489-40482511 GTGTCTCTGCTGGTGGGCTTGGG - Intergenic
1053930467 9:43110800-43110822 GTGTCTCTGCTGGTGGGCTTGGG - Intergenic
1054283234 9:63142446-63142468 GTGTCTCTGCTGGTGGGCTTGGG + Intergenic
1054293563 9:63318004-63318026 GTGTCTCTGCTGGTGGGCTTGGG - Intergenic
1054391585 9:64622493-64622515 GTGTCTCTGCTGGTGGGCTTGGG - Intergenic
1054504143 9:65893835-65893857 GTGTCTCTGCTGGTGGGCTTGGG + Intronic
1056291915 9:85152065-85152087 CTTTCTCTGCTGGAGTTCTATGG + Intergenic
1056647310 9:88425127-88425149 CTTTACCTTCTGGAGAGGTTTGG + Intronic
1057062727 9:92019970-92019992 CTTTGTCACCTGGAAGGGTTGGG + Intergenic
1058186084 9:101856696-101856718 CTCTTTCTGCTGCGGGGGTTGGG + Intergenic
1058396237 9:104557228-104557250 CTGTGGCTGCTGTAGGGGTTAGG - Intergenic
1060152778 9:121299503-121299525 ATTTTTTTGCTGGAGGTGTTAGG + Intronic
1060349588 9:122847202-122847224 TGTGCTCTGCTGGAGGGGGTTGG - Exonic
1060966177 9:127713427-127713449 CTTTCCCTGCTGGTGGGGGAGGG - Intronic
1062000947 9:134215394-134215416 CTTTTTCCCCTGGAGGGGCTGGG + Intergenic
1062239358 9:135527378-135527400 ATTTCTCTGCTCCAGGGCTTAGG + Intergenic
1189173699 X:38933414-38933436 CTTACTCTGGTGGAGGTGGTTGG + Intergenic
1192162598 X:68799711-68799733 CACTCTCTGCTGAAGGAGTTTGG + Intergenic
1192546008 X:72014957-72014979 CCTCCTTTGCTGGTGGGGTTGGG + Intergenic
1193076638 X:77362666-77362688 CCTGCTCTGGTGGAGGGGGTAGG + Intergenic
1194697465 X:97072098-97072120 ATTTCTATACCGGAGGGGTTTGG + Intronic
1194884531 X:99296649-99296671 CTGTCTCTGCTGCAGAGGCTGGG + Intergenic
1197120081 X:122880657-122880679 CTGTGTCTGCTGTTGGGGTTTGG - Intergenic
1197854065 X:130896159-130896181 CTGTCTCTGCTGTAGAGATTTGG - Intronic
1201772037 Y:17624527-17624549 TTTTCTCACCTGGAGGGGTCTGG - Intergenic
1201829518 Y:18281459-18281481 TTTTCTCACCTGGAGGGGTCTGG + Intergenic