ID: 1114318926

View in Genome Browser
Species Human (GRCh38)
Location 14:21530593-21530615
Sequence ATTTCTAATTGTAAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114318917_1114318926 25 Left 1114318917 14:21530545-21530567 CCCAAAGTGTTGGGATTACAGGC 0: 16492
1: 240790
2: 271963
3: 174140
4: 134914
Right 1114318926 14:21530593-21530615 ATTTCTAATTGTAAGGTGAAAGG 0: 1
1: 0
2: 0
3: 16
4: 254
1114318918_1114318926 24 Left 1114318918 14:21530546-21530568 CCAAAGTGTTGGGATTACAGGCG 0: 9450
1: 144047
2: 280281
3: 215306
4: 144319
Right 1114318926 14:21530593-21530615 ATTTCTAATTGTAAGGTGAAAGG 0: 1
1: 0
2: 0
3: 16
4: 254
1114318915_1114318926 28 Left 1114318915 14:21530542-21530564 CCTCCCAAAGTGTTGGGATTACA 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
Right 1114318926 14:21530593-21530615 ATTTCTAATTGTAAGGTGAAAGG 0: 1
1: 0
2: 0
3: 16
4: 254
1114318920_1114318926 -3 Left 1114318920 14:21530573-21530595 CCATCGCGCCCGGCCACCATATT 0: 1
1: 1
2: 34
3: 421
4: 2812
Right 1114318926 14:21530593-21530615 ATTTCTAATTGTAAGGTGAAAGG 0: 1
1: 0
2: 0
3: 16
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114318926 Original CRISPR ATTTCTAATTGTAAGGTGAA AGG Intronic
903526702 1:23996156-23996178 TTTGCCAATTGTAAAGTGAATGG - Intergenic
905872759 1:41414636-41414658 ATTTTTAAGTGAAAGGTCAAGGG + Intergenic
906921054 1:50064794-50064816 ATTACTAATTGTCAAATGAATGG - Intronic
907205780 1:52769717-52769739 ATTTCTAATTTAAGGGTGACTGG + Intronic
908130079 1:61066577-61066599 ATTTTTAGATGTAAGTTGAATGG - Intronic
908166273 1:61462397-61462419 ATTTCAAATTGTAGGGGGAGGGG + Intronic
911849260 1:102795455-102795477 ATTTCTAAATGTGAGTTAAATGG + Intergenic
912283529 1:108343425-108343447 ATTGATATTTGTATGGTGAAAGG - Intergenic
912308491 1:108595496-108595518 ATGCCTAATTGTATGGAGAAAGG + Intronic
912630209 1:111240274-111240296 ATTCCTATGTGTAAGATGAAGGG - Intronic
913445604 1:118947370-118947392 ATTTGTCATTTTATGGTGAAAGG + Intronic
913668852 1:121075750-121075772 AATTATAGTTGTAAGGAGAATGG + Intergenic
914020596 1:143863183-143863205 AATTATAGTTGTAAGGAGAATGG + Intergenic
914659094 1:149771101-149771123 AATTATAGTTGTAAGGAGAATGG + Intergenic
914919838 1:151839322-151839344 CCCTCTAACTGTAAGGTGAATGG - Intronic
917576361 1:176325346-176325368 ATTTTTAATTATAAAATGAAAGG + Intergenic
918731924 1:188009633-188009655 ATTACTAATTGCAATGTGATAGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922392005 1:225153836-225153858 ATTTTGAATTGTTAGGTCAAAGG + Intronic
923956015 1:239021898-239021920 ATTACTAATTGGAAGTGGAAGGG - Intergenic
923959928 1:239068481-239068503 ATATCAAATTTTAAGCTGAAAGG - Intergenic
924121364 1:240802100-240802122 ATTTCTAGTTGTAAAGGCAATGG + Intronic
1064594791 10:16932718-16932740 ACTTATAATTGTAATGTGACTGG - Intronic
1065473422 10:26107724-26107746 ATTTCTATTTGGAATGAGAAAGG - Intronic
1065474736 10:26122375-26122397 ATTTCTAATTGAAAGTTATAAGG + Intronic
1065895803 10:30162539-30162561 AATGCTAATTCTAAGGGGAAGGG - Intergenic
1066095438 10:32067737-32067759 ATTAGTAATTATAAGGAGAATGG + Intergenic
1066550387 10:36549482-36549504 TTTTCTAAATGCAAAGTGAAAGG + Intergenic
1066587395 10:36951030-36951052 GTTTTCAATTGTAAGGAGAATGG + Intergenic
1068062825 10:52090589-52090611 AGTTCAAACTTTAAGGTGAAAGG + Intronic
1071145303 10:82562793-82562815 ATTTCTAGCTGTAAGGGCAAGGG + Intronic
1071379987 10:85048896-85048918 ATTTCTATTTGTCTGGTTAATGG + Intergenic
1073545138 10:104341184-104341206 ATTTCTTATTGTAACTTCAATGG - Intergenic
1074989321 10:118688816-118688838 AATTGTAATTGTTAGGTGCATGG - Intronic
1075523546 10:123162000-123162022 ATTTTTTATTGTAATGTGCAAGG + Intronic
1077876744 11:6315655-6315677 AATTCTAATTGTGGGTTGAAAGG + Intergenic
1079662699 11:23060483-23060505 ATTTGAAAATGCAAGGTGAATGG + Intergenic
1079725379 11:23874160-23874182 ATTACTATTTGTATGGTCAAAGG + Intergenic
1080147139 11:28999943-28999965 CTATCTAAATGTTAGGTGAAAGG + Intergenic
1080366496 11:31580024-31580046 ATTTCTTTTTGCAAAGTGAAGGG - Intronic
1081767937 11:45625107-45625129 ATTTCTTATGATAAAGTGAATGG + Intergenic
1082861312 11:57859233-57859255 AGTTCTATTTCTAAGGTGGATGG - Intergenic
1083043928 11:59715088-59715110 ATTTCTAGTTGGAAGGAGAATGG - Intronic
1084527720 11:69707077-69707099 ATTTCTAACTGTAAAATGAAAGG - Intergenic
1085354484 11:75823191-75823213 ATTTATTATTGTAAATTGAAGGG + Intronic
1085786693 11:79457891-79457913 TTTTCTCACTGTAAAGTGAAGGG + Intergenic
1086643144 11:89185240-89185262 ATTTCTAATTTTAATGTATATGG + Intronic
1086723587 11:90152173-90152195 ATGTGTAATTGTATGGTAAAAGG + Intronic
1087334102 11:96821287-96821309 ATATCTAATTAGAAGGTCAAAGG + Intergenic
1091300779 11:134506337-134506359 ATTTCTATTACTAAGGAGAAAGG - Intergenic
1092733579 12:11557927-11557949 ACTTATAATTGTAAGGCTAAAGG - Intergenic
1092798325 12:12136817-12136839 ATTTCTAATATTAAAGAGAATGG - Intronic
1093593311 12:20932231-20932253 ATCTCTAATGGTAAAGAGAATGG - Intergenic
1094088257 12:26618161-26618183 ATTTCTGATTTTAAAGGGAATGG - Intronic
1097787934 12:63781317-63781339 TTGTCTAATTGGAAGGAGAAAGG - Intronic
1098480478 12:70952861-70952883 AATCCAAATTGTAAGGAGAATGG - Intergenic
1099318730 12:81118185-81118207 ATTTTTAAATGTTAGGTCAAAGG + Intronic
1099776900 12:87145581-87145603 ATTAAAAATTTTAAGGTGAATGG - Intergenic
1100301553 12:93312449-93312471 ATTTCTTCTTGTAAGGTCACTGG + Intergenic
1100936628 12:99677065-99677087 ATTTCTAATTTTAATGTAATAGG + Intronic
1101409898 12:104458738-104458760 TTTTCTAATTGCAAGGAGGAGGG + Intronic
1101713757 12:107292611-107292633 AGGTCTAGTTGCAAGGTGAAAGG + Intergenic
1101715004 12:107302896-107302918 GTTTCTGGTAGTAAGGTGAAAGG + Intergenic
1103925339 12:124420766-124420788 ATTTTACATTGTAAGGGGAACGG - Intronic
1104054394 12:125218333-125218355 TTTTCTCATTTTAAGGGGAAAGG - Intronic
1104618228 12:130288863-130288885 ATTTCTTATTGCAAAGTGTAAGG + Intergenic
1105252696 13:18714823-18714845 ATTTCTTTTTGTAAGCTGCAAGG + Intergenic
1106916949 13:34525947-34525969 ATTTGTGGTTGTAATGTGAAAGG + Intergenic
1106923027 13:34585011-34585033 TTTCCTAATTGTTTGGTGAAAGG - Intergenic
1107036005 13:35903194-35903216 ATTTCTAATCTTATGCTGAAGGG - Intronic
1107610018 13:42103684-42103706 ATTGCTAATGGCAAGGGGAAAGG + Intronic
1107986115 13:45777784-45777806 ATTTCTAAGGGAAAGGGGAAGGG - Exonic
1109165070 13:59023882-59023904 ATTTCTAATTTTAAAATGAAAGG + Intergenic
1110050991 13:70898778-70898800 ATTAATAATTGTAAGTTGGATGG - Intergenic
1110522517 13:76497398-76497420 TTTTCTTATTGTAAGTTGACAGG + Intergenic
1111731682 13:92084841-92084863 TTTTCTTATAGTAATGTGAATGG - Intronic
1114318926 14:21530593-21530615 ATTTCTAATTGTAAGGTGAAAGG + Intronic
1115149335 14:30266050-30266072 ATTTATAATTGTATTGTGCAGGG - Intergenic
1115497800 14:34024349-34024371 ACTTCCGATTGCAAGGTGAAGGG + Intronic
1115992828 14:39167210-39167232 ATTTCTCAATTTATGGTGAATGG - Intronic
1116027371 14:39531502-39531524 ATTTATCATTTTAAGTTGAATGG + Intergenic
1116628610 14:47299264-47299286 ATTTCTAATATTAAGGGGACAGG + Intronic
1117472071 14:56056293-56056315 ATTTCTAATTTCAATGTGAGAGG - Intergenic
1119505649 14:75170904-75170926 ATTCCTAAGTGAAAGGTTAATGG + Intronic
1120034320 14:79679162-79679184 ATTTCTTGTTGCAAGGTGCAAGG + Intronic
1122678179 14:103434848-103434870 ATTTCAAATTGGAAGGTATAGGG + Intronic
1125220992 15:37335036-37335058 TTTTCTCATAGTAAGGTGCATGG + Intergenic
1125302718 15:38273779-38273801 ATTTCTGATTGGAAGACGAAGGG + Intronic
1127776654 15:62269425-62269447 ATTTCCAACTGGAAGGGGAATGG - Intergenic
1128152051 15:65369298-65369320 TTTTCTGATTATAAGGTGAGGGG - Intronic
1128781253 15:70360075-70360097 ATTTCTAATTATGACTTGAAAGG + Intergenic
1129578131 15:76776018-76776040 GTTTTTAATTGTAAGATGGAGGG - Intronic
1131055231 15:89371036-89371058 ATTTCTAGGTGTAAAATGAAAGG - Intergenic
1133148071 16:3805449-3805471 ATTTCTACTTGTGCAGTGAAAGG + Intronic
1133871716 16:9694957-9694979 ATCTCGAATTGGGAGGTGAATGG - Intergenic
1140919877 16:79527649-79527671 TTTTATGATTGTAAGGTGATGGG - Intergenic
1140935067 16:79662757-79662779 ACTGCTAATTGTTTGGTGAATGG + Intergenic
1144427915 17:15161781-15161803 TTTTCTAATTGTAAGTTGCATGG - Intergenic
1146086625 17:29836699-29836721 TTTTCTAATTATAAAGTGAGAGG + Intronic
1149239671 17:54634468-54634490 ATTTTTAATTTTTATGTGAAGGG + Intergenic
1149243659 17:54680232-54680254 AGTTCTATTTCTCAGGTGAATGG + Intergenic
1151048924 17:70954282-70954304 GTTTCTAATTGGAAGAGGAAAGG + Intergenic
1151344719 17:73494572-73494594 AGTTCAAAGTGTAAGGGGAAAGG - Intronic
1152896609 17:82914856-82914878 ATTCCTACTTGAAAGCTGAAAGG - Intronic
1155760318 18:29557244-29557266 TTATTTTATTGTAAGGTGAATGG - Intergenic
1155983723 18:32207785-32207807 ATGTCTAGTTGTAATATGAATGG + Intronic
1156280851 18:35636554-35636576 ATTTCTCTTTGGAATGTGAATGG + Intronic
1158089788 18:53697427-53697449 GTTTCTAATTCTAATCTGAATGG - Intergenic
1168628806 19:57940531-57940553 ATTTCAAGTTGTTAGGAGAATGG + Intergenic
924984118 2:253086-253108 ATTTCAAATTGGAAGGTATAGGG + Exonic
926132319 2:10311553-10311575 AGAGCTCATTGTAAGGTGAAAGG + Intronic
928902392 2:36333784-36333806 ATTTCTATTTGATAGGTGAAGGG + Intergenic
929113709 2:38426629-38426651 ATTAGTAATTGTAAGAGGAATGG + Intergenic
930646391 2:53913525-53913547 ATTTTTATTTGGAAGGGGAAGGG - Intronic
931208937 2:60174284-60174306 ATTTGCAATGGTAAGGTCAATGG + Intergenic
933082440 2:78007822-78007844 ATTTCTAATTAAATGCTGAATGG + Intergenic
933266426 2:80185609-80185631 ATTGCAAATTGTAAGTGGAAAGG + Intronic
933351816 2:81162441-81162463 TTTTCTATTTGTAAAATGAATGG + Intergenic
934487428 2:94728847-94728869 ATTTCTTTTTGTAAGCTGCAAGG + Intergenic
938070653 2:128306602-128306624 CTTTCTAATTCTCAGGTGGATGG + Intronic
939452450 2:142391562-142391584 ATTTTTAAATGTTAAGTGAATGG + Intergenic
941457107 2:165722052-165722074 ATTACTAATGGGAAGCTGAAGGG + Intergenic
942016823 2:171826202-171826224 AATGCTAATTCTAAGGGGAACGG + Intronic
942090943 2:172490411-172490433 ATTTTAAATTCTAAGGTGACTGG + Intronic
942800104 2:179864813-179864835 ATATGTATTTGGAAGGTGAAAGG + Intergenic
942982454 2:182098998-182099020 ATTTTTTATTGCAAGGTGATGGG + Intronic
943530363 2:189072203-189072225 CTTTGTAATTTTAAAGTGAAAGG - Intronic
945238078 2:207651336-207651358 AACTCTAATTGAAATGTGAATGG + Intergenic
945459928 2:210094171-210094193 ATTTTTAAATGTAAGTTTAATGG - Intronic
945805081 2:214480432-214480454 CTCTCTAATTGTAAAATGAAAGG + Intronic
946658629 2:221976098-221976120 ATCTCTATTTGGAAGTTGAATGG + Intergenic
947036546 2:225864994-225865016 AATTATAACTGTAAGTTGAAAGG - Intergenic
1169837108 20:9892815-9892837 ATTTCAAATTAAAAGCTGAATGG - Intergenic
1169847645 20:10012109-10012131 ATTTTAAATTTTAATGTGAAAGG - Intronic
1170694600 20:18647198-18647220 ATTTCTATATGTAAAGTTAAGGG - Intronic
1173276501 20:41588853-41588875 ATTTCTAATCAAAAGGTGATTGG + Intronic
1174542798 20:51303255-51303277 ATGTCCAAACGTAAGGTGAATGG + Intergenic
1174957152 20:55110804-55110826 TTTTTTTATTGTAAGGAGAATGG + Intergenic
1176838213 21:13814710-13814732 ATTTCTTTTTGTAAGCTGCAAGG + Intergenic
1177163838 21:17578354-17578376 CTTTCTAAGTGAAAGGTGTATGG + Intronic
1179588970 21:42392728-42392750 ATTTCTAAGTATAAGACGAAGGG - Intronic
1181721654 22:24779946-24779968 AACTCTAATTAGAAGGTGAAAGG + Intergenic
949143541 3:665961-665983 ATTTCTTATTGCCAGCTGAATGG + Intergenic
950787290 3:15447310-15447332 ATTTCTATTGGTCAGGAGAATGG - Intronic
952989548 3:38819802-38819824 ATTTATCATTTTAAGGTGTACGG - Intergenic
953814651 3:46144653-46144675 ATTGCTAATGCGAAGGTGAATGG + Intergenic
956500806 3:69883009-69883031 ATTTTAAATTTCAAGGTGAAAGG - Intronic
956963918 3:74436190-74436212 ATTAGTAAATGTAAGTTGAAAGG - Intronic
956991283 3:74769160-74769182 ATTACCAATTGAAAGGAGAATGG - Intergenic
957402382 3:79733266-79733288 TTTTCTAACTGTATGGTTAATGG - Intronic
960914859 3:122684915-122684937 TTGTCTATTTGTAAGGTTAATGG - Intronic
961347171 3:126270886-126270908 ATTTCTTATTGAATTGTGAATGG - Intergenic
963926260 3:150954234-150954256 ATTGCTAGTGGGAAGGTGAATGG - Intronic
964920978 3:161895419-161895441 ATTTCTAATTTTTAGGTAATTGG + Intergenic
965232843 3:166075145-166075167 ATTTCTCATTTTATGCTGAAGGG - Intergenic
966253127 3:177889027-177889049 ATTTCTGATTGCAAGTTGCAAGG - Intergenic
967485963 3:190031182-190031204 ATTTCTAATTTATAGATGAAAGG + Intronic
969176172 4:5400555-5400577 ATTTCATACTGTGAGGTGAATGG + Intronic
969382681 4:6815369-6815391 ATTTCTAGTTGTGAACTGAAAGG - Intronic
970928309 4:21478944-21478966 TTTTCTAATTTTAAAATGAAGGG + Intronic
972647094 4:40979405-40979427 ATGTTGCATTGTAAGGTGAAGGG + Intronic
974199575 4:58621786-58621808 ATTTTTAATTTTATTGTGAATGG - Intergenic
974626963 4:64438224-64438246 ATTTCTTATTTTAAGGTATATGG + Intergenic
975373702 4:73617800-73617822 CTCTCTAACTGTAATGTGAAAGG + Intronic
975446406 4:74470678-74470700 ATTTCTAATTGCAATGGGAGTGG - Intergenic
976028264 4:80718716-80718738 ATTTTTAATTTACAGGTGAAAGG - Intronic
976100890 4:81561986-81562008 ATTACTAATAGTAAGTTGATAGG + Intronic
976426392 4:84907986-84908008 ATATCTACATGTAAGGTGCAAGG + Intronic
976540100 4:86264598-86264620 ATTTCTAATTAGAAGATGACAGG - Intronic
977060066 4:92247064-92247086 ATTTCTTATTGTAATGTGATTGG + Intergenic
977801010 4:101231371-101231393 ATTCCTAATTCTAAGATAAATGG - Intronic
977898155 4:102387214-102387236 ATTGCTCACTGTAAGGTAAAAGG + Intronic
978148566 4:105407587-105407609 ATTTCCAACAGTAATGTGAATGG + Intronic
978815778 4:112903164-112903186 GTTTCTCATTGGAAGGTGGAGGG + Intronic
980104223 4:128571830-128571852 GCTTCTATTTGTAAGTTGAAAGG + Intergenic
980296748 4:130928986-130929008 ATTTCTGATTGTCAGCGGAAGGG + Intergenic
980729396 4:136807054-136807076 ATTTCTAATGGTTAGGTACACGG + Intergenic
983146087 4:164216420-164216442 ATCTCTGAATTTAAGGTGAAAGG + Intronic
983147202 4:164231009-164231031 CCTGCTAGTTGTAAGGTGAAAGG - Intronic
984253331 4:177360767-177360789 ATTTCAAATTTAAAGGTAAAAGG - Intronic
984315210 4:178121253-178121275 ATTTCTTGTTGTAAGGAAAAGGG - Intergenic
984642316 4:182181237-182181259 ATTTCTTATTGTTAGGTTCAAGG - Intronic
984752370 4:183290168-183290190 ATACCTATTTGTAGGGTGAAAGG - Intronic
985071812 4:186173182-186173204 ATTTCTGGCTGTAAGGAGAAGGG + Intergenic
985310042 4:188587692-188587714 GTTTCTAGTTGTAAGTTGTAAGG + Intergenic
986795774 5:11210518-11210540 ATATCTACTTTTTAGGTGAATGG + Intronic
988569317 5:32348530-32348552 ATTTCTAATTGTATTGTTACTGG - Intergenic
990253781 5:53943941-53943963 ATTTTTAATTGCAAGATAAATGG + Intronic
990750265 5:59007259-59007281 ACTTTTAATTTTAAGGTGAAAGG - Intronic
993059361 5:83020547-83020569 GTTTCTAATTGTTTTGTGAATGG - Intergenic
993310273 5:86321686-86321708 ATTTCTAATACTATGGTGAAAGG - Intergenic
993604428 5:89970871-89970893 TTTTATAAATGTAAGGTGAAGGG - Intergenic
994008379 5:94869460-94869482 AGTTCTTAATGTAAGGTGATAGG - Intronic
996184121 5:120455917-120455939 ATTTATAAGTGTTAGGTTAAAGG + Intergenic
996803663 5:127430638-127430660 TTTTCTGACTGTAAGATGAAGGG + Intronic
997781520 5:136664045-136664067 ACTTCCTATTGTAAGGTGGAAGG - Intergenic
999307693 5:150530865-150530887 TTTTCTATTTTTAAAGTGAAAGG + Intronic
999790707 5:154937572-154937594 ATTCCTTACTGTAAGATGAATGG - Intronic
1001005445 5:168045757-168045779 ATTTGTAATTACCAGGTGAAGGG - Intronic
1005397677 6:25400072-25400094 AGATATAATTGTAAGGTGAATGG - Intronic
1005413507 6:25576229-25576251 TTTTTTAAATCTAAGGTGAATGG + Intronic
1005777068 6:29145684-29145706 ATTTCTAGTTGTAAGAATAAAGG + Intergenic
1008428951 6:51392331-51392353 ATTTATAAAGGTAAGGGGAAGGG + Intergenic
1012241530 6:96878388-96878410 ATTTCTCATTGTAATGAAAAAGG - Intergenic
1012487496 6:99738469-99738491 ATTTCTAAAGATAAGGTGAAAGG - Intergenic
1013941179 6:115664876-115664898 AATACTTATTGTATGGTGAAAGG + Intergenic
1014045363 6:116877777-116877799 ATTTCTGATTGCCAGTTGAAGGG - Exonic
1014259346 6:119198076-119198098 TTTTCTAAGTATAAGGTGACAGG - Intronic
1014353689 6:120376950-120376972 ATTTACAGTTGTGAGGTGAATGG - Intergenic
1014650734 6:124033826-124033848 ATTTCTAATAGTAACATTAAAGG + Intronic
1014727726 6:124992761-124992783 AATTCTAATTGTAAAGTAATTGG + Intronic
1014874458 6:126639927-126639949 ATTTTTAATTGTCAGTGGAAAGG + Intergenic
1015149535 6:130020935-130020957 ATTTTTAATTGTTAGGTTAGGGG + Intronic
1015193495 6:130498669-130498691 ATCTCTAATAGTAAATTGAAGGG - Intergenic
1015282771 6:131451695-131451717 CTTACTAAGTGTAAGGTGACTGG + Intergenic
1016337435 6:143022524-143022546 ATTTTTAATTGCAATGAGAATGG - Intergenic
1016682729 6:146849567-146849589 ATTTCTAATTATTTGGTGATTGG + Intergenic
1021090979 7:16482176-16482198 ATTTCTGTTTGCAAAGTGAAGGG - Intronic
1021534105 7:21683246-21683268 ATTTTTAACTGGAAGATGAATGG + Intronic
1021906282 7:25337146-25337168 TTGTCTTATTGTAAGGTAAAAGG - Intergenic
1023584825 7:41718374-41718396 ATTTCAAATTGTTATTTGAAGGG - Intergenic
1023739629 7:43267287-43267309 ATGTCTAATTGTATTGTGATCGG - Intronic
1023885645 7:44352628-44352650 ATTTCTAATTTTGAGATGATAGG + Intergenic
1025899309 7:65731238-65731260 AATTCTAATTCTAATGGGAAAGG + Intergenic
1027396963 7:77766559-77766581 ATTTCTTATTGTGAGGTGCTAGG + Intronic
1027925865 7:84462978-84463000 ATTTCTAACTATAAGAGGAAGGG - Intronic
1028417124 7:90593027-90593049 AATTCTAATTCTAAAGTTAATGG - Intronic
1030123823 7:106135850-106135872 ATTTCTAATTTGAAAGTTAAAGG - Intergenic
1031716596 7:125116123-125116145 ATATCTAAATGGAAGGGGAAGGG + Intergenic
1035612827 8:979593-979615 ATTTCTCATTATCAGGTAAAGGG + Intergenic
1036059815 8:5303501-5303523 ATTTTTAATTGTAAATTGACTGG - Intergenic
1037429358 8:18793475-18793497 ATTTCTAACTTTAAGGTCAGGGG - Intronic
1037432023 8:18823736-18823758 ATGTGTAATTGTAAGGAGAGAGG - Intronic
1040067555 8:43160165-43160187 ATTTAAAATTGTCAGTTGAAAGG + Intronic
1041733034 8:61081899-61081921 ATTTTTTATTGAAAGCTGAATGG - Intronic
1042505855 8:69559504-69559526 AATTCTAATTTTAACTTGAAAGG + Intronic
1043076024 8:75700547-75700569 ATTTCTGATTTTAAGGTTAGGGG - Intergenic
1043177014 8:77034178-77034200 CTTTCTAATTGTATGGAGAAGGG + Intergenic
1043534626 8:81188976-81188998 TTTTCTAAATCTAGGGTGAAAGG - Intergenic
1046298573 8:112256102-112256124 ATTAATAAATGTAAGTTGAATGG - Intronic
1047023964 8:120807439-120807461 ATTTCTCATTTTAAGGAGTAGGG - Intronic
1050014892 9:1223279-1223301 ATTTCTAAATGAAAGGAGAATGG - Intergenic
1050290259 9:4147043-4147065 ATTTCTAAATGTCAGGTGCTAGG - Intronic
1051685593 9:19655091-19655113 AATTATAATTTCAAGGTGAATGG - Intronic
1051930925 9:22384636-22384658 ATTTAGGATTGTAAGGTGAGGGG + Intergenic
1052365343 9:27606469-27606491 CTTTGTAATGGTAAGGAGAAAGG - Intergenic
1053670377 9:40355583-40355605 ATTTCTTTTTGTAAGCTGCAAGG - Intergenic
1053920167 9:42981846-42981868 ATTTCTTTTTGTAAGCTGCAAGG - Intergenic
1054381496 9:64495568-64495590 ATTTCTTTTTGTAAGCTGCAAGG - Intergenic
1054514236 9:66020717-66020739 ATTTCTTTTTGTAAGCTGCAAGG + Intergenic
1054838785 9:69712127-69712149 ATTTATCATTATAAGGTGATAGG - Intronic
1055284644 9:74715363-74715385 AAATCTAATTGTAATGAGAATGG - Intergenic
1055872850 9:80905075-80905097 TTTTCTAACAGTAAGGTGAAGGG - Intergenic
1056505756 9:87256879-87256901 ATCTCTAGTTGTGAAGTGAAAGG + Intergenic
1186306788 X:8269410-8269432 TTTTCTAATGCTATGGTGAATGG - Intergenic
1186643725 X:11484036-11484058 ATTTCAAATTGTAAAGTGCCTGG + Intronic
1186904300 X:14095011-14095033 ATTTTAAATTGTAGCGTGAAGGG + Intergenic
1187683012 X:21786977-21786999 ATTTATAATTGTTATGTGCATGG - Intergenic
1188472558 X:30557111-30557133 ATTTGTATTTGTAGAGTGAATGG - Intergenic
1189537619 X:41952612-41952634 ATATACAATTTTAAGGTGAAGGG + Intergenic
1189864772 X:45315559-45315581 GTTTTTCATTGTAAGGGGAAAGG - Intergenic
1191043323 X:56108275-56108297 ATTTCTGATCTTAAGGGGAAAGG + Intergenic
1194796949 X:98223547-98223569 ATTTGTAAATGTAAGGTGCAGGG - Intergenic
1195462202 X:105140184-105140206 AGTTCTAATAGGAAGGTAAAAGG - Intronic
1195468410 X:105207038-105207060 ATTTTCAACTTTAAGGTGAATGG - Intronic
1195733882 X:107993230-107993252 ATGTCAAATTGTAAGGTGATTGG - Intergenic
1195772431 X:108365762-108365784 ATTTCTAATAGTCAGGTGTGAGG + Intronic
1196671453 X:118372669-118372691 ATATGAAATTGTATGGTGAAGGG - Intronic
1197643950 X:128997001-128997023 ATTACTATTTCTAAGCTGAAGGG - Intergenic
1197961474 X:132011000-132011022 TTTTCTTATTGTAAAATGAAGGG - Intergenic
1198831715 X:140758248-140758270 ATTTAAAATTGTGATGTGAAAGG + Intergenic