ID: 1114319295

View in Genome Browser
Species Human (GRCh38)
Location 14:21533804-21533826
Sequence CAGCATTTGCATGTTGTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114319295 Original CRISPR CAGCATTTGCATGTTGTATA TGG Intronic
902394897 1:16127274-16127296 CAGCATTTGCATCCTGTGTGGGG - Intronic
903189255 1:21647577-21647599 CAACATGTGCTTGTTGAATAGGG - Intronic
904741834 1:32683332-32683354 CAGCCTTTGAATATTATATAAGG + Exonic
906796503 1:48700388-48700410 CAGCATTTGCATGGAGCATGGGG + Intronic
907593476 1:55698402-55698424 CATCATTTGCATATTGTCTATGG - Intergenic
907930614 1:58995895-58995917 CTGGATTTGCATGTTTTAAAGGG + Intergenic
908600622 1:65735276-65735298 CAGCATTTGCATGGTATTTAAGG - Intergenic
909244593 1:73263304-73263326 TTACATTTCCATGTTGTATAAGG + Intergenic
910623026 1:89276563-89276585 CAGCTTTTAGATGATGTATAAGG + Intergenic
912284352 1:108352952-108352974 CAGCATTTGCTTGTTGGGAAAGG + Intergenic
912415141 1:109503146-109503168 CAGTATTTTCATGTTGTAAATGG - Intergenic
913355016 1:117910899-117910921 CAGAATTTGCATGTTATTTCAGG - Intronic
913401111 1:118434186-118434208 CAGAACTTGCATGTAGTAAAAGG + Intergenic
913689872 1:121268978-121269000 CAGCATTTAGATGTTGGAAAAGG + Intronic
914147728 1:145011294-145011316 CAGCATTTAGATGTTGGAAAAGG - Intronic
915491791 1:156254134-156254156 AAGGATTTGCATGCTGTTTAGGG - Intronic
919351358 1:196458670-196458692 AAGCTTTGGCATGTTTTATAAGG + Intronic
920321058 1:205122924-205122946 CAGCATTTTCATGTTGCCCAGGG + Intergenic
920477195 1:206287455-206287477 CAGCATTTAGATGTTGGAAAAGG + Intronic
920611430 1:207441968-207441990 CAGCATTCACATATTGTAGAAGG - Intergenic
920716268 1:208343115-208343137 TAGCACATGCATGTTGTGTAGGG - Intergenic
920756145 1:208735605-208735627 CATGATTTGCCTGTAGTATAAGG + Intergenic
921632264 1:217449099-217449121 AATCATTTGCATGTGGTATCAGG - Intronic
921800521 1:219397765-219397787 CAGCATTTGCTTGTTTGAAAAGG + Intergenic
922679245 1:227577948-227577970 CAGCATTTGCTTGTCTTAAAAGG + Intronic
1063351622 10:5362088-5362110 CAGCATGAGCATGTTGTTCAGGG - Intergenic
1063455711 10:6181439-6181461 CAGCATTTCCTTCTTGTTTAAGG - Intronic
1064891465 10:20179243-20179265 CATCATTAGCATTTTGTGTAGGG + Intronic
1068172015 10:53405941-53405963 CAGCACATCCATGCTGTATATGG - Intergenic
1068311282 10:55279610-55279632 CCACATTTGCATTTTGTATTGGG + Intronic
1068325627 10:55482529-55482551 CAGCATTTGCTTGTTTGAAAAGG + Intronic
1068640182 10:59395860-59395882 TAGCATCTGCATATAGTATAAGG + Intergenic
1070366197 10:75739389-75739411 CAGCATATGAATTTTGTACATGG - Intronic
1071230228 10:83577994-83578016 CAGTGTTTGCATGTCTTATAAGG + Intergenic
1072524039 10:96255751-96255773 CTGCATTTTCCTGTTGTAAAGGG - Intronic
1073917253 10:108419900-108419922 CAGCGTATCCACGTTGTATATGG - Intergenic
1075947983 10:126454461-126454483 CAGCCTTTGCAGATTGTAGAAGG - Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078872181 11:15357889-15357911 CAGCAGTTTCATGCTGTGTAGGG - Intergenic
1080329696 11:31121623-31121645 CTGCTTTTTCATATTGTATATGG - Intronic
1080811820 11:35711973-35711995 CACCAATTGCATGTTTTAAAGGG + Intronic
1081026201 11:38018658-38018680 CAGTTTTTGGATCTTGTATAAGG - Intergenic
1084871888 11:72103837-72103859 CAGCATGTGAAGGTAGTATAAGG - Intronic
1086523860 11:87702282-87702304 CAGCATTTGCTTGTTCTATAAGG + Intergenic
1089436079 11:118468394-118468416 AAGCATTTGTTTGTTGTATTGGG + Intronic
1089592274 11:119550562-119550584 CATCATTTACATATTGTTTATGG - Intergenic
1090646791 11:128772935-128772957 CAGCACTTCCGTGTTGTAGAGGG - Exonic
1091188814 11:133672115-133672137 CTGCATTTTCATTTTGTATTTGG - Intergenic
1091997032 12:5001789-5001811 CAGCATTTGCATTCTGTGCATGG + Intergenic
1095215991 12:39548521-39548543 CAGCATCTGCATGTTGAAAAAGG + Intergenic
1096235610 12:49924088-49924110 CAGCATTGGCATGATGGAGAGGG + Intergenic
1098035483 12:66297568-66297590 CAGGCTTTGCATGCTATATATGG - Intergenic
1105431772 13:20343521-20343543 CAGCATTTGCACATTTTAGAGGG - Intergenic
1105526110 13:21179131-21179153 CACCAAATGCATATTGTATAGGG - Intergenic
1105628781 13:22140460-22140482 GAGCATTTGAATGTTGTGTTGGG + Intergenic
1105784601 13:23735955-23735977 CTGGATTTGGATTTTGTATATGG + Intronic
1107230349 13:38102260-38102282 CAGCAATTGCTTTTTATATAAGG - Intergenic
1107574566 13:41704112-41704134 CCACATTTGTATGTTGTATAGGG + Intronic
1109144044 13:58755175-58755197 CAGAATTTTCTTCTTGTATAAGG + Intergenic
1109318693 13:60782747-60782769 CAGAATTTGCTTCTTTTATAAGG + Intergenic
1112047373 13:95611939-95611961 GAGCATTTGTAAGTGGTATAAGG - Intronic
1112642760 13:101295400-101295422 GAGCATTTTCATGTAGAATATGG + Intronic
1114319295 14:21533804-21533826 CAGCATTTGCATGTTGTATATGG + Intronic
1115883590 14:37946747-37946769 CAGCATTTGCTTGTCTCATAAGG - Intronic
1116049529 14:39786065-39786087 CTGCATCTTCATGTTGAATAGGG + Intergenic
1117080356 14:52145383-52145405 CAGCAGTTGATTTTTGTATATGG + Intergenic
1117516100 14:56503086-56503108 CACCATATTCATGTTGTAAACGG - Intronic
1117664986 14:58047159-58047181 CTGCATTTGCATTGTGTTTACGG - Intronic
1120638070 14:86975755-86975777 CAGCATTTGCTTGTTTGAAAAGG - Intergenic
1122999524 14:105285485-105285507 CAGCGTTTGCATGTGATGTAAGG - Intronic
1123185781 14:106515763-106515785 CAGCATTTCCTTATTTTATAAGG - Intergenic
1202835196 14_GL000009v2_random:72675-72697 CAGCAATGGGATGTTTTATATGG - Intergenic
1124409661 15:29426287-29426309 CAACATTTGCATATTTTAGAAGG - Intronic
1125077779 15:35639562-35639584 CAGCATTTGCTTGTCTTAAAAGG - Intergenic
1125322841 15:38507210-38507232 CAGGATTTGCATTTTGCATATGG - Intronic
1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG + Intronic
1128668583 15:69557284-69557306 CAGCATTTCCATTTTGCACAGGG - Intergenic
1129623176 15:77168493-77168515 CATCTTTTACATGTTGTCTATGG - Intronic
1131715332 15:95103988-95104010 TAACATTTGCATGTGGTATGTGG - Intergenic
1137324517 16:47420750-47420772 CAGCATTTGCTTCTGGTAAAAGG - Intronic
1138098432 16:54232022-54232044 CTGCATCTGGATGTTTTATAAGG + Intergenic
1139453423 16:67050930-67050952 CAGCACATCCATGTTTTATAAGG - Intronic
1141939545 16:87265718-87265740 CAGCATTTCCAGGTATTATATGG - Intronic
1142661907 17:1436511-1436533 CAGCATTGGGATGTTGTAGATGG - Intronic
1143254383 17:5544735-5544757 CTGCATTTTCATTTTGTATTGGG + Intronic
1143713431 17:8749826-8749848 CCTCATTTGCATGTGGTTTATGG + Intergenic
1143776261 17:9201124-9201146 CAGAATTTGCATCTTGAAGAAGG + Intronic
1144555162 17:16275528-16275550 CAGCAATTCCATCTTGAATAGGG - Intronic
1144955881 17:19018599-19018621 TAGCATGTGCCTGTTGTAGAGGG + Intronic
1145199206 17:20925826-20925848 CAGTATTTGCCTTTTGTAAATGG + Intergenic
1147308954 17:39582772-39582794 CAGCATGTGCAAGTTGGAAATGG - Intergenic
1149650974 17:58276316-58276338 CACCATTGGCATGTAGTAAAGGG - Intronic
1155735458 18:29217167-29217189 CTGCATTTTCATTTTGTATTAGG - Intergenic
1155927880 18:31677414-31677436 CAGCATTTACATCCTGTATTAGG - Intronic
1158862776 18:61609066-61609088 CAGCATTGGCATTTTGATTATGG - Intergenic
1158902131 18:61973796-61973818 CAGCGTTTGCATATTAAATATGG + Intergenic
1160332459 18:78007009-78007031 CTGCATTTGCATGTTATCCATGG - Intergenic
1162634205 19:11953940-11953962 CAGCATTTTCTGGTTATATATGG + Intronic
1165663226 19:37601178-37601200 CAGGCTTTGCATGCTGTTTAGGG + Intronic
1202637432 1_KI270706v1_random:54674-54696 CAGCAATGGGATGTTTTATATGG + Intergenic
926873357 2:17447458-17447480 CAGCATTTGCTTGTCGGAAAAGG - Intergenic
927004288 2:18831993-18832015 GAGGATTTGCAAGTTGTTTAAGG + Intergenic
928504580 2:31937061-31937083 CTGCATTTGCAAATTATATAGGG - Intronic
928829603 2:35464367-35464389 ATGCATTTGCATATTGTCTATGG - Intergenic
929334950 2:40731132-40731154 TATCATTTGCATGTTTTATAAGG - Intergenic
929550493 2:42887703-42887725 CTGAATTAGCATCTTGTATATGG + Intergenic
929980972 2:46679860-46679882 CAGCATTTGGTTGGAGTATAAGG + Intergenic
933222111 2:79702343-79702365 CTTTATTTTCATGTTGTATATGG + Intronic
933687172 2:85151737-85151759 ATGCATTTGCATATTGTTTAGGG + Intronic
934569947 2:95363281-95363303 CTACATTTGCATGTGGGATATGG + Intronic
940439537 2:153698024-153698046 CAGCATTTGCTTGTCTGATAAGG - Intergenic
941193992 2:162423447-162423469 CAGCATCTGCATGTGGTACCTGG + Exonic
943511441 2:188831904-188831926 CATCTTTTGCATATTGTCTATGG + Intergenic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
944976561 2:205059702-205059724 CAGCATTTATATATTGTTTAAGG + Intronic
947139328 2:227007149-227007171 CAGCATTTGCTTAATGTGTAAGG + Exonic
948241063 2:236435401-236435423 CATCATTTACATGTTGTCTATGG + Intronic
949054277 2:241917047-241917069 CAGCATTTGCTTATTGGAAAAGG - Intergenic
1169016480 20:2296953-2296975 CAGCATTTGCCTGTTGCATTTGG - Intronic
1171273814 20:23837395-23837417 CAGCATTTGCTTTTTCTGTAAGG - Intergenic
1171884011 20:30638768-30638790 CAGCAATGGGATGTTTTATATGG + Intergenic
1175095523 20:56538554-56538576 CAGAATTTCCACGTTGTCTATGG + Intergenic
1176846880 21:13883660-13883682 CAGCAATGGGATGTTTTATATGG + Intergenic
1177078307 21:16606484-16606506 CTTCTTTTGCATGTTGTATTTGG + Intergenic
1177752371 21:25300734-25300756 TAGCATTTGCATATTGTTCATGG - Intergenic
1178722147 21:35019514-35019536 CAGCATTAGCATTTTCTATGAGG - Intronic
1180589582 22:16925475-16925497 CAGCATTTGCTTGTCTTAAAAGG - Intergenic
1184987043 22:48142788-48142810 CAGCATTTCCCTGGTGTATTTGG + Intergenic
949743330 3:7261802-7261824 CAGCATTTGCTTGTAGGAAAAGG + Intronic
950189213 3:10965089-10965111 CAGCATTTTCATTTTGCATTGGG + Intergenic
950799743 3:15540503-15540525 AAGACTTTGAATGTTGTATATGG - Intergenic
950962470 3:17120316-17120338 CAATCTTTGCATGTTGTCTATGG + Intergenic
952572520 3:34733749-34733771 CAGCATTTGCTTGTTTGAAAAGG - Intergenic
954642521 3:52109840-52109862 CAGCATTGCCATGTGGTGTAAGG - Intronic
957291548 3:78283224-78283246 CAGCATTTGCTTGTCGGAAAAGG - Intergenic
958826472 3:99036708-99036730 CAGCATTTGCTTGTCTGATAAGG - Intergenic
959169985 3:102832502-102832524 CAGCATTTGCTTGTTTGAAAAGG - Intergenic
959534020 3:107465360-107465382 CTGCATTTTCATTTTGTATCAGG + Intergenic
959747727 3:109796688-109796710 CAGCATTTGCTTGTTGGTAAAGG - Intergenic
960398673 3:117169198-117169220 CAGCATTATTATGTTGGATAAGG - Intergenic
961417715 3:126772940-126772962 CAGCATTTGCTTGTCGGAAAAGG + Intronic
962728446 3:138257359-138257381 AAGCATTTCCATGATGTATATGG + Intronic
964257709 3:154795870-154795892 CAGAACTTTCATGTTGCATAAGG - Intergenic
972083692 4:35185615-35185637 CAGCATTTGCATGTGTGAAAAGG - Intergenic
972850721 4:43046974-43046996 CAGCAGTTGCTTGTGTTATATGG - Intergenic
973367678 4:49221041-49221063 CAGCAATGGGATGTTTTATATGG + Intergenic
973393377 4:49574390-49574412 CAGCAATGGGATGTTTTATATGG - Intergenic
973673830 4:53243408-53243430 CAGCATTTGCATGTCTGAAAAGG - Intronic
973876766 4:55227901-55227923 TACAAATTGCATGTTGTATAAGG - Intergenic
975056128 4:69931730-69931752 CAGCATTTGTATGTTGATTAAGG + Intronic
975328637 4:73088936-73088958 ATTCATTTGCATATTGTATAAGG - Intronic
975657895 4:76659937-76659959 CAGCATATGCATGTTTTAGATGG - Intronic
976128982 4:81864182-81864204 GAGCAATGGCATATTGTATAAGG - Intronic
976673445 4:87678867-87678889 AAGCATTTGCATGTTCCTTATGG - Intergenic
976844988 4:89478402-89478424 CAGCATTTGCTTGTTCGAAAAGG - Intergenic
976852148 4:89560046-89560068 CAGTATTTGCATGTTTAATGTGG + Intergenic
977632777 4:99262011-99262033 CAGCATTTGCTTGTTGGGAAAGG + Intergenic
978275548 4:106945242-106945264 CATCACTTGCAAGTTGTAAATGG - Intronic
980101575 4:128546690-128546712 CAGCATTTTTCTGTTGTATTTGG + Intergenic
980326067 4:131348217-131348239 CAGCATTTGTAAATTGTATATGG + Intergenic
980706064 4:136497333-136497355 CAAGATTTTCATGTTGAATAAGG - Intergenic
981606216 4:146543974-146543996 CAGCATTTGCTTGTCATAAATGG + Intergenic
1202764748 4_GL000008v2_random:140530-140552 CAGCAATGGGATGTTTTATATGG + Intergenic
988450819 5:31341434-31341456 CAGCTTTTGCATGTTGGAGATGG - Intergenic
988674501 5:33417885-33417907 CACCATTTACATATTGTCTATGG + Intergenic
990536490 5:56728568-56728590 CAGCAGTTACATGATGTCTATGG - Intergenic
990679848 5:58230243-58230265 CAGCATTAGCATGCTACATATGG + Intergenic
990680837 5:58242524-58242546 CAGGATCTGCAGGTTTTATAAGG - Intergenic
991178386 5:63718698-63718720 CAGCACTAGCATGTTAGATATGG + Intergenic
991328223 5:65462092-65462114 CAGTATTTGCATTTAATATAGGG - Intronic
991536353 5:67673142-67673164 CTACATTTGAATGGTGTATATGG + Intergenic
993662270 5:90652645-90652667 CACCAATTGCATTTTGTATATGG - Intronic
994551220 5:101237759-101237781 CAGCATTTGCTTGTTCAAAAAGG + Intergenic
994642970 5:102433462-102433484 GAGGGTTTGCTTGTTGTATAAGG + Intronic
996639274 5:125732223-125732245 CAGCATTTGCTTGTTTGAAAAGG - Intergenic
1001114039 5:168923935-168923957 AATCATTTACATGTTGTCTACGG + Intronic
1005517097 6:26565301-26565323 CATCATCTCCATTTTGTATAAGG + Intergenic
1006189661 6:32199996-32200018 TAGCATTTGGATGTTGTATTAGG + Intronic
1008235334 6:49039823-49039845 CAGAATTTACATCTTTTATAAGG + Intergenic
1008710650 6:54222541-54222563 CAGGATTTCCTTGTTGTTTAAGG + Intronic
1010081932 6:71873575-71873597 CAGCCTTTTCATTTGGTATAAGG - Intergenic
1012075219 6:94674150-94674172 GAGCATTTGCTTGTTGGAAAAGG - Intergenic
1013943931 6:115699551-115699573 CAGGATTTCCTTGTTTTATAAGG + Intergenic
1014564191 6:122928792-122928814 CAGCATTTGCTTGTTTGAAAAGG + Intergenic
1015002811 6:128240429-128240451 CTGCCATAGCATGTTGTATATGG + Intronic
1015823492 6:137287754-137287776 AAGCATTTGCAGGTTGCATAGGG + Intergenic
1016761461 6:147742011-147742033 CAGTCTTTGCATGTTGAATATGG - Intergenic
1016931154 6:149411330-149411352 CAGGCTTTGCATTTTGTATATGG + Exonic
1020718109 7:11704261-11704283 CAGCATTTTCATATTGAATAGGG + Intronic
1020723962 7:11785472-11785494 CAGCATTTCCATTTTGTAAAGGG + Intronic
1022013964 7:26332737-26332759 CAATATTTGTATGTGGTATAAGG + Intronic
1023282530 7:38585765-38585787 CACCATTTGAGTGTGGTATATGG + Intronic
1024138200 7:46432072-46432094 CAGCATGTGCATGTGGCAGAGGG - Intergenic
1026119849 7:67527189-67527211 TACCATTTTCATTTTGTATATGG - Intergenic
1028143134 7:87293115-87293137 CAGCATTTGCTTGTCTGATAAGG - Intergenic
1028514906 7:91667028-91667050 CAACATTTCCATGATTTATATGG + Intergenic
1029678943 7:102094220-102094242 CAGCATTTGAATATTGTTTTGGG - Intronic
1032423080 7:131798902-131798924 CAGGATTTGCATGAAGTACAAGG - Intergenic
1033293526 7:140109407-140109429 CAGCATTTCCTTCTTTTATAAGG + Intronic
1038865829 8:31437906-31437928 TAGCATTTGGTTGTTGTATTTGG + Intergenic
1039688118 8:39830386-39830408 CATCATTTGCATACTGTTTATGG + Intronic
1039818147 8:41112944-41112966 CAGCATTTGCATATTCCAAAAGG + Intergenic
1041536279 8:58928786-58928808 TAGCATTTGCAAGTTTCATACGG + Intronic
1042943273 8:74128959-74128981 GAGCATTTACATGTATTATATGG + Intergenic
1043233534 8:77831832-77831854 CAGCATTTGCTTGTCTTAAAAGG - Intergenic
1045549496 8:103158071-103158093 CAACATCTGCATGTTGTATTTGG + Intronic
1045624653 8:104029348-104029370 GAGCAACTGCATGTTGAATAGGG - Intronic
1046276163 8:111963322-111963344 CAGCATTTGCTTGTTTGAGAAGG + Intergenic
1046727591 8:117691883-117691905 CAGCATTTTCATTTTGAAAAGGG + Intergenic
1047895331 8:129360278-129360300 AAGGCTTTGCTTGTTGTATATGG - Intergenic
1048637608 8:136315019-136315041 CATTATTTTCATGTTGTTTAGGG + Intergenic
1048794323 8:138135094-138135116 CATCATTTACATATTGTATATGG - Intronic
1049950768 9:641488-641510 CTCCATTTGCATGTTGTTCATGG - Intronic
1050682347 9:8126943-8126965 CAGCATTTCCTTCTTGTTTAAGG + Intergenic
1051204508 9:14670480-14670502 CATCATTTACATATTGTCTATGG + Intronic
1055793373 9:79947495-79947517 CTGTTTTTACATGTTGTATAGGG + Intergenic
1055919246 9:81440710-81440732 CAACATTTGCATGTTATCAATGG + Intergenic
1056010982 9:82329924-82329946 TAGCACTTGGATGTTGTGTAAGG - Intergenic
1056491358 9:87110623-87110645 CATCATTTGCATGTAGTATAAGG - Intergenic
1056926082 9:90835512-90835534 AAGCATTTGCAGGTTGTTTTGGG + Intronic
1058153665 9:101487863-101487885 CATCATTTACATATTGTCTATGG + Intronic
1202798843 9_KI270719v1_random:154162-154184 CAGAATTGGCATCTTTTATATGG + Intergenic
1203545498 Un_KI270743v1:125418-125440 CAGCAATGGGATGTTTTATATGG + Intergenic
1187364488 X:18655331-18655353 GAGCATTTACATATTGTTTATGG + Intronic
1188151771 X:26685354-26685376 AAGTATTTCCATGTTGTAAATGG - Intergenic
1189055702 X:37697506-37697528 CAGAATTTGAATGCTGAATAGGG - Intronic
1189733388 X:44045304-44045326 CAGCAACTCCATGTTGAATAGGG + Intergenic
1189943614 X:46153931-46153953 GAGTATTTGTATGTTGTATTAGG + Intergenic
1192082545 X:68062353-68062375 CTTCATTTACATGTTGTCTATGG - Intronic
1193391342 X:80932098-80932120 CAGAGTTTGATTGTTGTATAAGG - Intergenic
1193610702 X:83628754-83628776 CAGCATTTGCTTATTTTAAAAGG + Intergenic
1193705259 X:84813236-84813258 GAGCAATTCCATGTTGTGTAGGG - Intergenic
1193758613 X:85439016-85439038 CAGTATTTGCTTGTTTTAAAAGG + Intergenic
1194144820 X:90248715-90248737 CAGCATTTGCTTGTTCGAAAAGG - Intergenic
1194602989 X:95946589-95946611 CAGCATATGTATTTTGTAGAAGG - Intergenic
1194933071 X:99912814-99912836 CTGCAATTGCATGTTGTTTCAGG - Intergenic
1196330373 X:114465972-114465994 CAGCAGTTTCTTTTTGTATAGGG - Intergenic
1198196601 X:134369400-134369422 ATGTATTTGCATTTTGTATATGG - Intergenic
1198758222 X:140002832-140002854 CAGCATTTGCTTGTTGGGAAAGG - Intergenic
1200490578 Y:3818019-3818041 CAGCATTTGCTTGTTCGAAAAGG - Intergenic
1201052934 Y:9958286-9958308 GAGCATTTGCATATTTTATTTGG + Intergenic
1201501338 Y:14646232-14646254 CAGCAGCTGCATTTTGAATATGG - Intronic
1202064879 Y:20928405-20928427 CAGCAGTACCATGTAGTATATGG + Intergenic
1202101838 Y:21317483-21317505 GAGCATTTGCATATTTTATTTGG + Intergenic