ID: 1114325347

View in Genome Browser
Species Human (GRCh38)
Location 14:21583295-21583317
Sequence TCCCAATGTGGAGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114325337_1114325347 7 Left 1114325337 14:21583265-21583287 CCAACCTCAGGTGATCCACCCAC 0: 1795
1: 5448
2: 9952
3: 12422
4: 15121
Right 1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG No data
1114325334_1114325347 26 Left 1114325334 14:21583246-21583268 CCAGGCTGGTTTCGATCTCCCAA 0: 2
1: 20
2: 1087
3: 11292
4: 136697
Right 1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG No data
1114325339_1114325347 -8 Left 1114325339 14:21583280-21583302 CCACCCACCTCAGCCTCCCAATG 0: 155
1: 24756
2: 88020
3: 174436
4: 195622
Right 1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG No data
1114325336_1114325347 8 Left 1114325336 14:21583264-21583286 CCCAACCTCAGGTGATCCACCCA 0: 1018
1: 18504
2: 48001
3: 83990
4: 103686
Right 1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG No data
1114325338_1114325347 3 Left 1114325338 14:21583269-21583291 CCTCAGGTGATCCACCCACCTCA 0: 4906
1: 20582
2: 48775
3: 75197
4: 87746
Right 1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114325347 Original CRISPR TCCCAATGTGGAGGGATTAC AGG Intergenic
No off target data available for this crispr