ID: 1114327861

View in Genome Browser
Species Human (GRCh38)
Location 14:21607431-21607453
Sequence CTGAGCAAAGAGTTGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114327853_1114327861 15 Left 1114327853 14:21607393-21607415 CCAGACTTGACCACAGCCCTTTT No data
Right 1114327861 14:21607431-21607453 CTGAGCAAAGAGTTGAAGCAAGG No data
1114327855_1114327861 5 Left 1114327855 14:21607403-21607425 CCACAGCCCTTTTAGGCCATTAG No data
Right 1114327861 14:21607431-21607453 CTGAGCAAAGAGTTGAAGCAAGG No data
1114327858_1114327861 -2 Left 1114327858 14:21607410-21607432 CCTTTTAGGCCATTAGGCAGCCT No data
Right 1114327861 14:21607431-21607453 CTGAGCAAAGAGTTGAAGCAAGG No data
1114327857_1114327861 -1 Left 1114327857 14:21607409-21607431 CCCTTTTAGGCCATTAGGCAGCC No data
Right 1114327861 14:21607431-21607453 CTGAGCAAAGAGTTGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114327861 Original CRISPR CTGAGCAAAGAGTTGAAGCA AGG Intergenic
No off target data available for this crispr