ID: 1114331091

View in Genome Browser
Species Human (GRCh38)
Location 14:21637840-21637862
Sequence CTTTCTTTCAACAGGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114331091_1114331100 15 Left 1114331091 14:21637840-21637862 CCAGGCTCCCTGTTGAAAGAAAG No data
Right 1114331100 14:21637878-21637900 TAGGTTCTGGGTTCCCTGCCTGG No data
1114331091_1114331094 -4 Left 1114331091 14:21637840-21637862 CCAGGCTCCCTGTTGAAAGAAAG No data
Right 1114331094 14:21637859-21637881 AAAGCTCTTTTTACCCCTCTAGG No data
1114331091_1114331095 2 Left 1114331091 14:21637840-21637862 CCAGGCTCCCTGTTGAAAGAAAG No data
Right 1114331095 14:21637865-21637887 CTTTTTACCCCTCTAGGTTCTGG No data
1114331091_1114331096 3 Left 1114331091 14:21637840-21637862 CCAGGCTCCCTGTTGAAAGAAAG No data
Right 1114331096 14:21637866-21637888 TTTTTACCCCTCTAGGTTCTGGG No data
1114331091_1114331104 26 Left 1114331091 14:21637840-21637862 CCAGGCTCCCTGTTGAAAGAAAG No data
Right 1114331104 14:21637889-21637911 TTCCCTGCCTGGGAGGAGGCAGG No data
1114331091_1114331101 16 Left 1114331091 14:21637840-21637862 CCAGGCTCCCTGTTGAAAGAAAG No data
Right 1114331101 14:21637879-21637901 AGGTTCTGGGTTCCCTGCCTGGG No data
1114331091_1114331102 19 Left 1114331091 14:21637840-21637862 CCAGGCTCCCTGTTGAAAGAAAG No data
Right 1114331102 14:21637882-21637904 TTCTGGGTTCCCTGCCTGGGAGG No data
1114331091_1114331103 22 Left 1114331091 14:21637840-21637862 CCAGGCTCCCTGTTGAAAGAAAG No data
Right 1114331103 14:21637885-21637907 TGGGTTCCCTGCCTGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114331091 Original CRISPR CTTTCTTTCAACAGGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr