ID: 1114331658

View in Genome Browser
Species Human (GRCh38)
Location 14:21643026-21643048
Sequence ATCTAATAGCAAATGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114331652_1114331658 16 Left 1114331652 14:21642987-21643009 CCTTCTTTATGTTTCCATGAAGA No data
Right 1114331658 14:21643026-21643048 ATCTAATAGCAAATGCTGCTGGG No data
1114331656_1114331658 2 Left 1114331656 14:21643001-21643023 CCATGAAGATGGGAGGTAAGTCT No data
Right 1114331658 14:21643026-21643048 ATCTAATAGCAAATGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114331658 Original CRISPR ATCTAATAGCAAATGCTGCT GGG Intergenic
No off target data available for this crispr