ID: 1114335342

View in Genome Browser
Species Human (GRCh38)
Location 14:21683651-21683673
Sequence CAACAGAGCTTGCATGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114335337_1114335342 5 Left 1114335337 14:21683623-21683645 CCATCCCCCACAGAAGAAGGTAA No data
Right 1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG No data
1114335335_1114335342 9 Left 1114335335 14:21683619-21683641 CCTTCCATCCCCCACAGAAGAAG No data
Right 1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG No data
1114335339_1114335342 0 Left 1114335339 14:21683628-21683650 CCCCACAGAAGAAGGTAAGAAAT No data
Right 1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG No data
1114335334_1114335342 10 Left 1114335334 14:21683618-21683640 CCCTTCCATCCCCCACAGAAGAA No data
Right 1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG No data
1114335340_1114335342 -1 Left 1114335340 14:21683629-21683651 CCCACAGAAGAAGGTAAGAAATC No data
Right 1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG No data
1114335338_1114335342 1 Left 1114335338 14:21683627-21683649 CCCCCACAGAAGAAGGTAAGAAA No data
Right 1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG No data
1114335341_1114335342 -2 Left 1114335341 14:21683630-21683652 CCACAGAAGAAGGTAAGAAATCA No data
Right 1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG No data
1114335333_1114335342 19 Left 1114335333 14:21683609-21683631 CCGTCTGAGCCCTTCCATCCCCC No data
Right 1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG No data
1114335332_1114335342 23 Left 1114335332 14:21683605-21683627 CCTTCCGTCTGAGCCCTTCCATC No data
Right 1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114335342 Original CRISPR CAACAGAGCTTGCATGCCCC TGG Intergenic
No off target data available for this crispr