ID: 1114336745

View in Genome Browser
Species Human (GRCh38)
Location 14:21698280-21698302
Sequence AACCCCGTGCTCTCTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114336739_1114336745 11 Left 1114336739 14:21698246-21698268 CCTTGGGATGCTGTTAATCTATA 0: 464
1: 169
2: 591
3: 458
4: 1243
Right 1114336745 14:21698280-21698302 AACCCCGTGCTCTCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114336745 Original CRISPR AACCCCGTGCTCTCTGAAAC AGG Intergenic
No off target data available for this crispr