ID: 1114344484

View in Genome Browser
Species Human (GRCh38)
Location 14:21780951-21780973
Sequence CAGTACCCAAAGTCCAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 3, 1: 31, 2: 75, 3: 183, 4: 336}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114344484_1114344497 15 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344497 14:21780989-21781011 AGGCTTGGAGTAGGGGCCAAGGG No data
1114344484_1114344500 29 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344500 14:21781003-21781025 GGCCAAGGGAAGCTTGGTGTGGG No data
1114344484_1114344490 -8 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344490 14:21780966-21780988 GGGTACTGTTGAACATGGGAAGG No data
1114344484_1114344494 7 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344494 14:21780981-21781003 TGGGAAGGAGGCTTGGAGTAGGG No data
1114344484_1114344491 -5 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344491 14:21780969-21780991 TACTGTTGAACATGGGAAGGAGG No data
1114344484_1114344499 28 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344499 14:21781002-21781024 GGGCCAAGGGAAGCTTGGTGTGG No data
1114344484_1114344496 14 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344496 14:21780988-21781010 GAGGCTTGGAGTAGGGGCCAAGG No data
1114344484_1114344495 8 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344495 14:21780982-21781004 GGGAAGGAGGCTTGGAGTAGGGG No data
1114344484_1114344493 6 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344493 14:21780980-21781002 ATGGGAAGGAGGCTTGGAGTAGG No data
1114344484_1114344498 23 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344498 14:21780997-21781019 AGTAGGGGCCAAGGGAAGCTTGG No data
1114344484_1114344492 0 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344492 14:21780974-21780996 TTGAACATGGGAAGGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114344484 Original CRISPR CAGTACCCAAAGTCCAGAGG GGG (reversed) Intergenic
900233939 1:1577649-1577671 GAGCACTCAAAGTCCAGAGCGGG - Intergenic
901403615 1:9031679-9031701 CTGTGCCCAAATTCCAGAGGGGG + Intergenic
901936544 1:12630779-12630801 TGGTTCCCAAAGTCCAGAGGGGG - Intergenic
902644810 1:17790837-17790859 CAGCATCCAAAATTCAGAGGGGG + Intronic
903337567 1:22635258-22635280 CAGTGCCCAAAGTCCAGAGGGGG + Intergenic
903672175 1:25043012-25043034 CAGTGCCCAAAGTCTGGAGGGGG + Intergenic
904039240 1:27574906-27574928 CAGGCCCCAGAGTCCAGAGAAGG - Intronic
904370036 1:30042551-30042573 CAGTGCCCAAAGTCTGGAGGGGG - Intergenic
904460985 1:30679715-30679737 TGGTGCCCAAAGTCCAGAGGGGG - Intergenic
904551724 1:31324692-31324714 TGGCACCCAAAGTCCAGAGGGGG - Intronic
905374958 1:37514232-37514254 CAGCCTCCAAAGTCCAGACGGGG + Intronic
905417469 1:37814067-37814089 CTGTATGCAAAATCCAGAGGGGG + Exonic
905771109 1:40638598-40638620 CAGATCCCAGAGTCCAGAAGGGG + Intronic
906132484 1:43468933-43468955 TAGTGCCCAAAGTCTGGAGGGGG + Intergenic
906269146 1:44460700-44460722 CAGGACCCAAAGTCTAGCAGAGG - Intronic
906448318 1:45922463-45922485 CAGTGCCCAAAGCCTGGAGGGGG + Intronic
906547092 1:46627464-46627486 AAATCCCCAAAGTCCAGAGATGG - Intergenic
907152910 1:52305905-52305927 CAGTGCCCAAAGTCCAGAGGGGG - Intronic
907168835 1:52441683-52441705 CAGTACTGAAAGTCCAGTTGAGG + Intronic
907761757 1:57368154-57368176 CAGTGCTCAAAGTCCAGAAGGGG - Intronic
908520170 1:64934004-64934026 CAGCTCCCAAATTCCAGAGGTGG - Intronic
910101563 1:83583324-83583346 CAGCACCGAAAGTCTGGAGGGGG + Intergenic
910655017 1:89610238-89610260 CAGTGCCCAAAGTCCAGAGGGGG + Intergenic
911024961 1:93426732-93426754 CAATGCCCAAAGTCTGGAGGGGG - Intergenic
911266887 1:95753622-95753644 CAGTGCCCAAAGTCTGGAGGCGG - Intergenic
911275499 1:95853551-95853573 CAGCACCCAAAGTTTGGAGGGGG - Intergenic
911475025 1:98363543-98363565 GAATACCCAAACTCCAGAGGAGG - Intergenic
911497730 1:98651165-98651187 CGGCACCCAAAGTCCAGAGAGGG + Intergenic
911799784 1:102121396-102121418 CAGTCCTCAGAGCCCAGAGGTGG - Intergenic
912039364 1:105368056-105368078 CAGTGAACAAAGTCCAGAGGTGG + Intergenic
912094409 1:106120977-106120999 CAGTCCTCAAAGCCCAGAGGGGG - Intergenic
912431561 1:109630838-109630860 CAGGACCCCAAATGCAGAGGAGG - Intronic
912436325 1:109664222-109664244 AAGTACCCAAAAACCAGAGAAGG - Intronic
914392789 1:147237074-147237096 TGGCACCCAAAGTCCTGAGGGGG + Intronic
915751253 1:158212992-158213014 CAGAGCCCAAAGTCCAGAGGAGG - Intergenic
919205789 1:194420578-194420600 TGGCACCCAAAGTTCAGAGGAGG + Intergenic
919752876 1:201049028-201049050 AACTTCCCAAAGCCCAGAGGGGG + Exonic
921674742 1:217965254-217965276 CAGTGCCAAAAGTACGGAGGGGG + Intergenic
921706034 1:218323738-218323760 TGGCACCCAAAGTCCGGAGGGGG + Intronic
922132695 1:222795308-222795330 TGGTGCCCAAAGTCCAGAAGTGG - Intergenic
923328102 1:232898457-232898479 CAGTGCCCAAAGTCCAGAGGGGG - Intergenic
924948762 1:248863781-248863803 TGGCGCCCAAAGTCCAGAGGGGG - Intergenic
1062870904 10:903281-903303 GTATACCCAGAGTCCAGAGGAGG + Intronic
1064837628 10:19551616-19551638 CAGTACTCAAAGTCCAGGCCAGG - Intronic
1065407825 10:25388981-25389003 TGGTGCCCAAAGTCTAGAGGGGG - Intronic
1065806067 10:29394722-29394744 CCCTGCCCAAAGTCCAGAGGGGG - Intergenic
1065893890 10:30144370-30144392 CAGTTCACCAAGTCCTGAGGAGG + Intergenic
1067718140 10:48705113-48705135 CAGGAGCCAAGGTCCAGACGTGG + Intronic
1068060663 10:52064228-52064250 TGGCACCCAAAGCCCAGAGGGGG + Intronic
1068137572 10:52965643-52965665 CAGTGACCAAAGTCCTGTGGGGG + Intergenic
1068213525 10:53952789-53952811 TGGTGCCCAAAGTCCAGAGTGGG + Intronic
1068938388 10:62657731-62657753 TGGTGCCCAAAGTCCGGAGGAGG - Intronic
1069298330 10:66875154-66875176 AATTACACAAAGTCCAGTGGTGG + Intronic
1069592912 10:69652873-69652895 CAGTGCCCAAAGTCCAGAGAGGG - Intergenic
1070201237 10:74207979-74208001 CTGCACCTAAAGTCCAGAGGGGG + Intronic
1070401438 10:76056576-76056598 CAGCACCCAAAGTCCAGAAGGGG + Intronic
1071429405 10:85594852-85594874 CAGTTCCCAAAGACCAGAGCTGG - Intergenic
1071886102 10:89952049-89952071 TAGCCCCTAAAGTCCAGAGGGGG + Intergenic
1072753261 10:97999472-97999494 TGGCACCCAAAGTCCAGAGGGGG - Intronic
1072871397 10:99124547-99124569 TGGCACCCAAAGTCCAGAGGGGG + Intronic
1073260788 10:102188733-102188755 CAGTGCCCAAAGTCCAGAGGGGG + Intergenic
1073721594 10:106178953-106178975 CAGAACCCACAGTCTAGAGGGGG + Intergenic
1073845022 10:107544929-107544951 CGGTGCCCAAAGTCCAGAGGGGG - Intergenic
1074365371 10:112853557-112853579 CTGTACCCACATTCCACAGGTGG + Intergenic
1074991602 10:118713106-118713128 CAGTGCCCAAAGTCCGGAGGGGG + Intronic
1075007740 10:118842660-118842682 TGGCACCCAAAGTCCAGAGGGGG - Intergenic
1075132144 10:119748990-119749012 CGGCACCCGAAGTCCAGAGGGGG + Intronic
1075660079 10:124187364-124187386 AAGTAAACAAAGTCCAGAGGTGG + Intergenic
1075746341 10:124730549-124730571 GAGAACCAAAAGTGCAGAGGAGG - Intronic
1076655209 10:132019326-132019348 CAATGCCCAAAGTCTGGAGGGGG + Intergenic
1077900788 11:6486577-6486599 CAGTAACTAAAGTTCAGAGTGGG - Intronic
1077938795 11:6818164-6818186 TGGTGCCCAAAGTTCAGAGGAGG - Intergenic
1078303267 11:10156263-10156285 TGGTTACCAAAGTCCAGAGGTGG - Intronic
1078315237 11:10289060-10289082 CAGGGCCCAAAGTCCAGAGGGGG + Intronic
1078345594 11:10544969-10544991 CAGTGTCCAAAGTCCAGAGGGGG + Intergenic
1079184172 11:18221403-18221425 CAATGCCCAAAGTCCAGAGGGGG + Intronic
1079504022 11:21133553-21133575 CAGTGCCCAAAGTCCAGAAGGGG + Intronic
1080852028 11:36078404-36078426 CTTCACCCAAAGTCCGGAGGCGG + Intronic
1080967051 11:37224990-37225012 TGGTGCCCAAATTCCAGAGGGGG + Intergenic
1081011044 11:37812536-37812558 AGGTGCCCAAAGTCCGGAGGGGG + Intergenic
1081044169 11:38250886-38250908 CAGCACCCAAAGTCTGGAGAGGG + Intergenic
1081164009 11:39786169-39786191 TTGTGCCCAAAGTCCAGAGGAGG + Intergenic
1081284066 11:41246238-41246260 CGGCACCCAAAGTCCAGAGTGGG + Intronic
1081767450 11:45621439-45621461 CAGCACCCAAAGTCCAGAGGGGG + Intergenic
1081867608 11:46368103-46368125 CAGCACCCAAAGGGCAGGGGCGG - Intronic
1083305031 11:61757650-61757672 CAGAACCCAAATCTCAGAGGGGG - Intronic
1083808061 11:65086932-65086954 CAGTACCCCTGGACCAGAGGAGG + Exonic
1083916021 11:65744272-65744294 CAGTGCCCAAAATCTGGAGGTGG - Intergenic
1085100519 11:73796457-73796479 TGGTGCCCAAAGTCCAGAGGGGG - Intronic
1085496816 11:76978013-76978035 CAGTGCCTAAAGTCCAGAGGGGG - Intronic
1086000468 11:81978355-81978377 GAGTTCCCAAAGGCCATAGGTGG - Intergenic
1086013987 11:82142163-82142185 AAGAACACAAAGTTCAGAGGTGG + Intergenic
1086249264 11:84794810-84794832 CAGCAGCCAAAGTCCAGAGGGGG - Intronic
1086268300 11:85028548-85028570 GGGCACCCAAAGTCCAGAGGGGG + Intronic
1086508349 11:87528883-87528905 GGGCACCCAAAGTCCAGAGGGGG + Intergenic
1086598032 11:88598181-88598203 CAGTACTATAAGTCCTGAGGGGG - Intronic
1087085843 11:94218301-94218323 CAGGACATACAGTCCAGAGGAGG + Intergenic
1087131340 11:94671836-94671858 TGGTGCCCAAAGTCTAGAGGGGG - Intergenic
1087289079 11:96299982-96300004 CAGGAACCAAAGTTAAGAGGAGG + Intronic
1087442941 11:98208480-98208502 CGGTGTCCAAAGTCCAAAGGGGG + Intergenic
1088288045 11:108207526-108207548 CAGAGCTCAAAGTCCAGAGGGGG + Intronic
1088328875 11:108629359-108629381 CAGTGCCCAAAGTCTGGAGAGGG + Intergenic
1090041868 11:123298972-123298994 CAGTGCCCAAAGTCTGGAGGGGG - Intergenic
1091408480 12:223802-223824 CCATGCCCAAAGGCCAGAGGAGG + Intronic
1091972217 12:4797030-4797052 CAGTAGCCAGAGTCCAGGGAAGG - Intronic
1092728036 12:11503572-11503594 CAGAACACAAAGTCCAGAAGTGG - Intergenic
1093493060 12:19726289-19726311 CAGTGCCCAAAGTCTGGAGAGGG + Intergenic
1093502479 12:19828226-19828248 TGGTGCCCAAAGTCCAGAGGGGG + Intergenic
1093525778 12:20102333-20102355 TAGTGCCCAAAGTCTGGAGGGGG + Intergenic
1093661093 12:21757876-21757898 AACTATCCAAAGTTCAGAGGTGG - Intergenic
1094018030 12:25884802-25884824 CGGCACCCAAAGTCCGGATGGGG - Intergenic
1095042263 12:37455823-37455845 CGGTGTCCAAAGTCCAGAGGGGG - Intergenic
1095826042 12:46531247-46531269 CAGCGGTCAAAGTCCAGAGGGGG - Intergenic
1096716964 12:53497453-53497475 CAGTGACCAGATTCCAGAGGAGG - Intronic
1096944757 12:55392294-55392316 CTGCACCCAAAGTCCAGAGGGGG + Intergenic
1097130006 12:56804858-56804880 TGGCACCCAAGGTCCAGAGGCGG + Intergenic
1097130945 12:56810308-56810330 CAGTGCCCAATGTCTGGAGGGGG + Intergenic
1097492035 12:60282662-60282684 TGGTGCCCAAAGTCCACAGGGGG + Intergenic
1097572953 12:61356288-61356310 CAGTGCCCAAAATCTGGAGGCGG + Intergenic
1099033677 12:77559880-77559902 CAGCGCCCAAAGTCCGGAGGGGG - Intergenic
1099295280 12:80821995-80822017 TAGTGCCCAAAGTCCACAGAGGG - Intronic
1099561014 12:84174059-84174081 CAGTGCCCAAAGTCTGGAGGGGG + Intergenic
1099682274 12:85844153-85844175 CAGAGCCCAAAGTCCAGAGGGGG - Intergenic
1099713829 12:86264908-86264930 CAGTGCCCAAAATCCAGAGAGGG - Intronic
1100368682 12:93944766-93944788 AAGAAGGCAAAGTCCAGAGGTGG + Intergenic
1100456506 12:94756735-94756757 AAGAACTCAAAGTCCAGTGGTGG + Intergenic
1100847845 12:98678846-98678868 CAGCACCCAAAGTCCGGAGGGGG - Intronic
1101580939 12:106040369-106040391 CGGTGCCCAAAGTCCACAAGGGG + Intergenic
1104219228 12:126766148-126766170 CAGGACCCAAAGTCTTGGGGAGG + Intergenic
1104742466 12:131188602-131188624 CAGCACCCAAAGTCTGGAGGGGG - Intergenic
1105041813 12:132966951-132966973 CAGTGCCCAATGTCCAGAGGGGG - Intergenic
1106253572 13:28002041-28002063 CGGTGTCCAAAGTCCAGAGGGGG + Intergenic
1106308851 13:28535346-28535368 CCATTCCCAAAGTCCAGAGGGGG - Intergenic
1106325382 13:28684301-28684323 CGGCACCCAAAGTCTGGAGGGGG - Intergenic
1106357813 13:29000926-29000948 CTGTTCCCAAAGTGCAGAGATGG + Intronic
1106379475 13:29222934-29222956 TGGTGCCCAAAGTCCAGAGGGGG - Intronic
1106999612 13:35527527-35527549 GGGTGCCCAAAGTCCAGACGGGG + Intronic
1107005263 13:35602442-35602464 CTGAACCCGAAGTCCAGAGTTGG - Intronic
1107147002 13:37070169-37070191 CAGTGCCCAAAGTCCGGAGGGGG - Intergenic
1107545139 13:41427902-41427924 CAGTTCACAATCTCCAGAGGGGG + Intergenic
1107699882 13:43036769-43036791 TTGTGCCCAAAGTCTAGAGGGGG + Intronic
1107841084 13:44458827-44458849 CGGTGCCCAAGGTCCAGAGGGGG - Intronic
1107853399 13:44591942-44591964 CAGTGCCCAAAATCCAGAGGGGG - Intergenic
1108017064 13:46086818-46086840 CAGTACCCAAAGTCCAGAGGGGG + Intronic
1108118738 13:47160357-47160379 CAGCGCCCAAAGTCCACAGGGGG - Intergenic
1108183677 13:47867106-47867128 CAGTGCCCCAAGTCCAATGGGGG - Intergenic
1108844405 13:54660173-54660195 CGGCACCCAAAGTTCAGAGGGGG + Intergenic
1109470590 13:62799304-62799326 TGGCACCCAAAGTCCGGAGGGGG - Intergenic
1109603541 13:64662989-64663011 TGGTGCCCAAAGTCCAGAGAGGG - Intergenic
1109686607 13:65829651-65829673 CAGTGCCCAAAGTCTAGAGGGGG - Intergenic
1109762260 13:66845282-66845304 CGGTGCCCAAAGTCCAGAGGGGG + Intronic
1109837401 13:67877623-67877645 CAGTACCTAACATCCAGAGGGGG - Intergenic
1109982243 13:69924088-69924110 CGGTGCCCAAGGTCCAGAGGGGG - Intronic
1109988070 13:70016593-70016615 CGGTGCCCAAAATTCAGAGGGGG - Intronic
1110014778 13:70386849-70386871 CAGTACCCAAAGTCTGGAGGGGG + Intergenic
1110201096 13:72851451-72851473 CAGTGTCCAAAGTCCAGAGGAGG - Intronic
1110730848 13:78877110-78877132 AGGTGCCCAAAATCCAGAGGGGG + Intergenic
1110777941 13:79432292-79432314 CGGAGCCCAAAGTCCAGAGGGGG - Intergenic
1111202893 13:84962278-84962300 TGGTGCCCAAAGTCCGGAGGGGG + Intergenic
1111237750 13:85431189-85431211 CAGTGCCTGAAGTCCAGAGGGGG - Intergenic
1111243682 13:85508092-85508114 TGGTACCCAAAGTCCAGAGGGGG - Intergenic
1111253639 13:85638895-85638917 TGGTACCTAAAGTCCAGAGGGGG + Intergenic
1113000807 13:105633877-105633899 CATTACATAAAGTGCAGAGGAGG + Intergenic
1114344484 14:21780951-21780973 CAGTACCCAAAGTCCAGAGGGGG - Intergenic
1114980571 14:28158396-28158418 CGGTGCCCAAAGTCCTGAGGGGG + Intergenic
1115484955 14:33901582-33901604 TGGTGCTCAAAGTCCAGAGGAGG - Intergenic
1116159797 14:41253767-41253789 CAGTGCCCAAAGTCTGGAGGCGG + Intergenic
1116617220 14:47154689-47154711 CACTACCTAAAGTCCGGAGGTGG - Intronic
1116790031 14:49330132-49330154 TGGCACCCAAAGTCCAGAGGGGG + Intergenic
1116961603 14:50973260-50973282 CAGCACCCAAAGTCCAGAGGGGG - Intergenic
1117930836 14:60838943-60838965 CATTCCCCAAAGTCCAGAGGGGG - Intronic
1118262978 14:64265484-64265506 CAGTAGCCTAAATCCAGAGCTGG + Intronic
1118522065 14:66596513-66596535 TGGTACCCAAAGTCTGGAGGGGG + Intronic
1118947071 14:70398460-70398482 TGGTGCCCAAAGTCCAGAGAGGG + Intronic
1119036122 14:71231591-71231613 TGGTACCTAAAGTCCAGAGGGGG - Intergenic
1119257239 14:73208960-73208982 CAGCACCCAAAGTCCAGAGGGGG + Intronic
1122386130 14:101349372-101349394 CAGTGCCCAAAGTCCAGAAGGGG + Intergenic
1122453304 14:101829462-101829484 CAGAACCCCAAGTCCAGGTGGGG - Intronic
1122491189 14:102117097-102117119 CATTACCAAAAGTCCAAAGAGGG - Intronic
1202840200 14_GL000009v2_random:114400-114422 CAGTGCCCAAAGTCTGGAGGGGG - Intergenic
1202909581 14_GL000194v1_random:104597-104619 CAGTGCCCAAAGTCTGGAGGGGG - Intergenic
1202883697 14_KI270722v1_random:84705-84727 CAGTGCCCAAAGTCTGGAAGGGG + Intergenic
1125241512 15:37582249-37582271 CAGTGCCCAGAGTCCGGAGGGGG - Intergenic
1125381650 15:39092619-39092641 CAGTGCCCAAAGTCTGGAGGGGG + Intergenic
1125545311 15:40499051-40499073 CAATCCCCAAAGTCATGAGGGGG + Intergenic
1125718048 15:41830832-41830854 TGGCACCCAAAGGCCAGAGGGGG - Intronic
1126292677 15:47099698-47099720 CAGTGTTCAAAGTTCAGAGGGGG + Intergenic
1127378548 15:58407644-58407666 CAATAAGCAAAGCCCAGAGGGGG - Intronic
1129091990 15:73160896-73160918 CATTCCCCAAACTCCAGAAGGGG - Intronic
1129157582 15:73728407-73728429 CAGTTCGCAAGGTCCAGAGAGGG - Intergenic
1129183504 15:73891785-73891807 CGGTGCCCAAAGTCCAGAGGGGG - Intergenic
1130183103 15:81651553-81651575 CAGTGCCCAAAGTCCAGAGGGGG - Intergenic
1131605747 15:93900941-93900963 CAGTGCCCAAAGTCCAGAGGGGG + Intergenic
1132305290 15:100807643-100807665 CAGTGCCCAAAGTCTGGAGGGGG - Intergenic
1132978970 16:2725159-2725181 CAGCGCCCAAAGTCCGGAGATGG - Intergenic
1134078467 16:11308681-11308703 CAGTGCTCAAAGTCCAGAGGGGG + Intronic
1134254538 16:12600605-12600627 TGCCACCCAAAGTCCAGAGGGGG - Intergenic
1134808488 16:17146212-17146234 TAGTAGCCAATGTCTAGAGGTGG - Intronic
1135331738 16:21566145-21566167 CAGTAAACAAAGTCCAGGAGAGG + Intergenic
1138033589 16:53580327-53580349 TGGTACCCAGAGTCCAGACGGGG + Intergenic
1138925156 16:61581590-61581612 TGGCACCTAAAGTCCAGAGGGGG + Intergenic
1138998188 16:62477980-62478002 CAGTGCCCAAAGTCTAGAGGGGG - Intergenic
1139150913 16:64381200-64381222 CAGTGTCCAAAGTCTGGAGGGGG - Intergenic
1139625885 16:68188036-68188058 CAGTGCCCAAAGTCTGGAGGGGG + Intronic
1142484719 17:239147-239169 CAATACCCAGCGTCCAGGGGAGG + Intronic
1142806395 17:2373242-2373264 CAGGACCCAAGGTCCAGTGCAGG + Intronic
1143073486 17:4318374-4318396 CGGTACCCCAAGGCCACAGGAGG + Intronic
1144374958 17:14630063-14630085 CAGTTCCCAAAGTCGAGGTGGGG - Intergenic
1146359110 17:32159705-32159727 CAGTGCCTGAAGTCTAGAGGAGG - Intronic
1148902394 17:50888222-50888244 CAGATCCCAAAGGCGAGAGGAGG + Intergenic
1149677585 17:58479591-58479613 TAGTACCCCAAGGCCAGATGTGG - Intronic
1150529090 17:65958600-65958622 TGGCAGCCAAAGTCCAGAGGTGG - Intronic
1150950910 17:69801590-69801612 CAGCATCCCAAGTCCGGAGGTGG - Intergenic
1151773047 17:76177484-76177506 CAGTGCCCAAAGTCTGGAAGGGG - Intronic
1151960083 17:77401162-77401184 CAGTACCCCCAGTACAGATGGGG - Intronic
1152232705 17:79122291-79122313 TAGAACCCAAAGTCCTGAGACGG + Intronic
1152530303 17:80914690-80914712 TGGTGCCCAAAGTCCAGAGGGGG - Intronic
1152608229 17:81303518-81303540 CAGTCCCCAAACCCCAGTGGTGG - Intergenic
1153428031 18:4987781-4987803 TAGTGCCCAAAGTCTGGAGGGGG + Intergenic
1153428844 18:4993234-4993256 CAGCACCCAAAGTCTGGAGGGGG + Intergenic
1154346645 18:13548447-13548469 TGGCACCCAAAGTCCAGAAGGGG + Intronic
1154357586 18:13633539-13633561 CAGCACCCAAAGTCCGGAGGGGG + Intronic
1155215712 18:23641527-23641549 CAGCACCCAAAGTCCGGAGGGGG - Intronic
1155819132 18:30352754-30352776 CAGTACCCAAAGTCTGGAGGGGG - Intergenic
1156011502 18:32502003-32502025 AAGTACCCAAACTGCAGAAGTGG - Intergenic
1156244481 18:35284487-35284509 CAGCACCCAAAGTCTGGAGGGGG + Intronic
1157506613 18:48230999-48231021 TGGCACCCAAAGTCCAGAGGGGG - Intronic
1158023430 18:52869696-52869718 CAGCACCCAAAGTCTAGAGGGGG + Intronic
1158198130 18:54910725-54910747 TGGTGCCCAAAGTCCAGAGGGGG + Intronic
1158787988 18:60739660-60739682 CAGCACCCAAAGTCCAGAGGGGG - Intergenic
1159519125 18:69495821-69495843 CAGCACCCAAAGTCCAGAGGGGG + Intronic
1159766953 18:72502698-72502720 CAGTGTCCAAAGTCCCGAGGGGG + Intergenic
1159774328 18:72585820-72585842 TGGCACCCAAAGTCCAGAGATGG + Intronic
1160754607 19:750993-751015 CAGGAAACAAAGTCCAGAGGAGG - Intergenic
1160929903 19:1565753-1565775 CAGAACGCACAGGCCAGAGGTGG + Intronic
1161781756 19:6297700-6297722 CAGCACCCAAGGTCCAGAGGGGG - Intergenic
1162870829 19:13585481-13585503 CAGTACCCATTTTACAGAGGAGG - Intronic
1163572549 19:18090962-18090984 CAGAGGCAAAAGTCCAGAGGAGG + Intronic
1163711237 19:18848372-18848394 CAGTGCCCAAATTCCAAGGGGGG + Intronic
1166230787 19:41425003-41425025 CAGGAAACAAAGACCAGAGGTGG - Exonic
1166557885 19:43713528-43713550 CAGGACTCAGAGTCCAGTGGTGG - Intergenic
1166897421 19:46032705-46032727 CGGTGCCCAAAGTCTGGAGGGGG - Intergenic
1167608060 19:50492354-50492376 CTGTACCCAACCCCCAGAGGAGG - Intergenic
1168351605 19:55679328-55679350 CAGTAACCAAAGACCAAAGGTGG - Intronic
1202659122 1_KI270708v1_random:51853-51875 CAGTGCCCAAAGTCTGGAAGGGG + Intergenic
926554496 2:14341548-14341570 CAGCACCCAAAGTCTGGAGGGGG - Intergenic
926859339 2:17292016-17292038 CAGTGCCCAAAGTCCAGAAGGGG + Intergenic
927236524 2:20880271-20880293 CAGCGCCCAAAGTCTGGAGGGGG + Intergenic
927533915 2:23837136-23837158 CGGCACCCAAAGTCTGGAGGGGG + Intronic
927870439 2:26619702-26619724 CAGGACCCAAAGCCCACAGCGGG + Intronic
928470322 2:31568819-31568841 CAGCACCCAAAGTCTGGAGGGGG + Intronic
928637831 2:33266259-33266281 TGGTGCCCAATGTCCAGAGGGGG - Intronic
928733617 2:34261061-34261083 GAGTACCCAAACTGCAGAAGTGG + Intergenic
928823583 2:35391998-35392020 CGGTACCCAAAATCCAGAGGAGG + Intergenic
929492397 2:42408091-42408113 AGGCACCCAAAGTCCAGAGGGGG - Intronic
929928874 2:46236929-46236951 GAGGACCCAAAGTCCAGGAGGGG - Intergenic
930728961 2:54709484-54709506 CGGTGCCCAAAGCCCAGAGGAGG - Intergenic
930946706 2:57084494-57084516 CAGTGCCTAAAGTCTGGAGGGGG + Intergenic
930971237 2:57397819-57397841 TAGTGCCCAAAGTCTGGAGGAGG + Intergenic
931500005 2:62855320-62855342 CGGTGCCCAAAATCCAGAAGGGG - Intronic
931510840 2:62991759-62991781 CAGTCCCCATAGTCCGCAGGTGG - Intronic
932054798 2:68433080-68433102 CAATGCCCTAAGTCCAGACGGGG + Intergenic
932356816 2:71074053-71074075 CAATCCCCAACGCCCAGAGGAGG - Intronic
932398324 2:71463178-71463200 CAGTGCTCAAAGTCTGGAGGGGG + Intronic
933042532 2:77487462-77487484 GGGAATCCAAAGTCCAGAGGGGG - Intronic
934696587 2:96404720-96404742 CAGCACTCAAAGTCCAGAGGGGG + Intergenic
935518813 2:104078527-104078549 CAGTGCCCAAAGTCCAGAGGGGG + Intergenic
937164092 2:119795452-119795474 TGGCACCCAAAGTCCAGAGGGGG + Intronic
937167740 2:119836854-119836876 CAGCGCCCAAAGTCCAGAGGGGG - Intronic
937370889 2:121296469-121296491 CAGTGCCCAAGGTCTGGAGGGGG + Intergenic
937834603 2:126459660-126459682 CAGGACCCAAATTGCAGAGACGG + Intergenic
938096475 2:128467329-128467351 TGGCACCCAAAGTCCAGAGAGGG + Intergenic
938722128 2:134076390-134076412 CAGTGCCCAAAGTCTGGAGGGGG + Intergenic
939886106 2:147683570-147683592 CAGTAGGAAAAGTCCACAGGAGG + Intergenic
940396328 2:153196332-153196354 CAGTGCCCAAAGTCTAGAGGGGG + Intergenic
940398764 2:153222676-153222698 CAGCACCCAAAATCCAGAGGGGG + Intergenic
940422873 2:153499648-153499670 TCGCACCCAAATTCCAGAGGGGG + Intergenic
940957007 2:159738970-159738992 TGGTGCCCAAAGTCCAGACGGGG + Intronic
941043562 2:160648875-160648897 TGGCATCCAAAGTCCAGAGGGGG - Intergenic
941131005 2:161650764-161650786 TGGCACCCAAAGTCCAGAGGTGG - Intronic
941151363 2:161919160-161919182 CAGTGCACAAAGTCCAGAGAGGG - Intronic
941404763 2:165074650-165074672 GGGCACCCAAAGTCCAGAGAGGG - Intergenic
941432287 2:165427051-165427073 TGGCACCCAAAGTCCAGAGGGGG - Intergenic
941667226 2:168254334-168254356 TATTACCCAAAGTCCAGAGCTGG + Intergenic
941998821 2:171626668-171626690 CAGTGACCAAAGTCCAAAGGGGG - Intergenic
942053537 2:172162605-172162627 CAGTGCCCAAAGTCCGGAGGGGG + Intergenic
942651511 2:178173933-178173955 CAGTCCACAAAGTCTAGAAGAGG - Intergenic
943064058 2:183068998-183069020 CAGTACCCAAAGTCCCAAGAGGG - Intergenic
943097232 2:183444102-183444124 TATTGCCCAAAGTCCAGAGTTGG - Intergenic
943179493 2:184524849-184524871 TGGTGCCCAAAGTCCAGAGGGGG + Intergenic
943189948 2:184663386-184663408 CAGTGCCCAAAGTCTAGAGGGGG - Intronic
943191726 2:184685963-184685985 CAGTGCCCAAAGTCTGGAGGGGG + Intronic
943345706 2:186734795-186734817 GAGTGCCCAAAGTCCGGAAGGGG + Intronic
943396223 2:187338669-187338691 TGGCACCCAAAGTCCAGAAGGGG + Intergenic
943427045 2:187750156-187750178 TGGTGCCCAAATTCCAGAGGGGG + Intergenic
943726370 2:191255782-191255804 CAATACTCAAAATGCAGAGGGGG - Intronic
943858370 2:192828209-192828231 CAGCACCCAATGTCTAAAGGAGG - Intergenic
943928535 2:193819853-193819875 AGGTGCCCAAAGTCCAGAGGAGG + Intergenic
943965513 2:194327680-194327702 CAGCGCCCAAAGTCCGGAGGGGG - Intergenic
944022752 2:195125845-195125867 CAGTGCCCAAAGTCTGGAGGGGG + Intergenic
944022808 2:195126120-195126142 CAGTGCCCAAAGTCTGGAGGGGG - Intergenic
945770449 2:214035476-214035498 TGGTGCCCAAAGTCCAGAGGGGG + Intronic
946197504 2:218043909-218043931 CAGTGCCCAAAGTCCAGAAGGGG + Intronic
947089571 2:226495149-226495171 AAGTCCCCAAAGTCCATTGGGGG - Intergenic
947316641 2:228866265-228866287 TTGTGCCCAAAGTCCAAAGGGGG - Intronic
948434479 2:237943911-237943933 TGACACCCAAAGTCCAGAGGGGG - Intergenic
948575457 2:238946896-238946918 CAGTGCCCAAAGTCCAGAGGGGG + Intergenic
948631278 2:239304223-239304245 CAGGACACAAAGCCCAGAGCTGG + Intronic
948712943 2:239836528-239836550 TGGTGCCCAAAGTCCAGAGGGGG - Intergenic
1168914479 20:1475110-1475132 CATTGCCAAAAGTCCAGTGGGGG + Exonic
1168983461 20:2027098-2027120 CAGCACCCAAAGTCCAGAGGGGG + Intergenic
1169134475 20:3188977-3188999 CAGTACCCAAAGGCCAGGAGTGG - Intergenic
1169144218 20:3241819-3241841 CAGATCACAAAGTCCAGAGATGG + Intergenic
1169632398 20:7647762-7647784 TGGTGCCCAAAGTTCAGAGGGGG + Intergenic
1170043923 20:12065825-12065847 CAGCGCCCAAAGTCTGGAGGGGG + Intergenic
1170327802 20:15176134-15176156 GGGTTCCCAAAGTCTAGAGGGGG - Intronic
1170500954 20:16974900-16974922 CAGCAACCAAAGTCTGGAGGGGG - Intergenic
1171285955 20:23938226-23938248 CAGCTCCCACAGTCCAGAGGGGG - Intergenic
1171536697 20:25898895-25898917 CGGTGTCCAAAGTCCAGAGGGGG - Intergenic
1171804411 20:29662262-29662284 CGGTGTCCAAAGTCCAGAGGGGG + Intergenic
1171839634 20:30194160-30194182 CGGTGTCCAAAGTCCAGAGGGGG - Intergenic
1175001371 20:55633440-55633462 TGGTGCCCAAAGTCCAGATGGGG + Intergenic
1175001405 20:55633621-55633643 TGGTGCCCAAAGTCCAGAGGAGG + Intergenic
1175138502 20:56842599-56842621 CAACACCCAAAGTCTGGAGGGGG - Intergenic
1175312920 20:58024350-58024372 TGGCACCCAACGTCCAGAGGGGG + Intergenic
1175832809 20:61976413-61976435 AAGTACCCCGATTCCAGAGGAGG + Intronic
1176408347 21:6434084-6434106 CAGTGCCCAAAGTCCAGAGGGGG - Intergenic
1176582368 21:8543394-8543416 CAGTGTCCAAAGTCCAGAAGGGG + Intergenic
1176599120 21:8775759-8775781 CACTGCCCAAAGTCTGGAGGGGG + Intergenic
1176628931 21:9119305-9119327 CAGTGCCCAAATTCTGGAGGGGG - Intergenic
1176645063 21:9342037-9342059 CAGTTCCCAAAGTGTGGAGGGGG + Intergenic
1176993174 21:15522413-15522435 CAGTGCCCAAAGTCCAGAGGGGG + Intergenic
1177037466 21:16061118-16061140 CAGTGCCCAAAGTTCAGAGGAGG + Intergenic
1177460028 21:21397449-21397471 AGGTGCCCAATGTCCAGAGGGGG + Intronic
1177875453 21:26626178-26626200 TGGCACCCAAAGTCTAGAGGGGG + Intergenic
1178467135 21:32858924-32858946 CAGTGCCCAATGTCTAGAGGAGG + Intergenic
1179683840 21:43042410-43042432 CAGTGCCCAAAGTCCAGAGGGGG - Intergenic
1180265203 22:10520442-10520464 CAGTGTCCAAAGTCCAGAAGGGG + Intergenic
1180326581 22:11435377-11435399 CAGTGCCCAAAGTCTGGAAGGGG + Intergenic
1180342023 22:11627532-11627554 AGGTGCCCAAAGTCCAGCGGTGG + Intergenic
1180367890 22:11957197-11957219 CAGTTCCCAAAGTGTAGAGGGGG - Intergenic
1180378200 22:12114139-12114161 CAGTGCCCAAAGTCTGGAGGGGG + Intergenic
1180419310 22:12799142-12799164 CACTGCCCAAAGTCTGGAGGGGG - Intergenic
1180556461 22:16581759-16581781 CAGGAACCAAAGTCCAGGTGGGG - Intergenic
1183316854 22:37141736-37141758 TGGTGCCTAAAGTCCAGAGGGGG - Intronic
1184426549 22:44412198-44412220 CAGTGCCCAGAGGTCAGAGGAGG - Intergenic
1184869481 22:47226163-47226185 TGGTGCCCAAAGTCCAGAGGAGG + Intergenic
1185411144 22:50683732-50683754 CAGAAGCCAAACTGCAGAGGGGG + Intergenic
949226282 3:1699686-1699708 TAGCACCCAAAGTGCAGAGTGGG - Intergenic
949738659 3:7204251-7204273 CAGTATTTAAAGTTCAGAGGAGG + Intronic
951136288 3:19107530-19107552 TGGTGCCCAAAGTCCAGAGGGGG + Intergenic
951264769 3:20552671-20552693 TGGCACCCAAAGTCCAGAGGAGG + Intergenic
951718522 3:25674078-25674100 TGGCACCCAAAATCCAGAGGGGG + Intergenic
952408484 3:33026354-33026376 CGGTGCCCAAAGTCCAGAGGGGG - Intronic
952793287 3:37217396-37217418 CAGTGCCCAAAGTCCAGAGGGGG - Intergenic
953163733 3:40445445-40445467 CAGTGCCCAAAGTCCGGAAGGGG - Intergenic
953748244 3:45591368-45591390 CGGCACCCAAAGTCTGGAGGGGG + Intronic
953766498 3:45747244-45747266 TGGTGCCCAAAGTCCAGAGGGGG - Intergenic
953801984 3:46031466-46031488 CGGTGCACAAAGTCCAGAGGGGG - Intergenic
953856427 3:46502860-46502882 CAGTATACAAAGGCCAGAGATGG + Intergenic
954497973 3:50983132-50983154 GGGCACCCAAAGTCCAGAGGGGG - Intronic
954497980 3:50983152-50983174 GTGTACCCAAAGTCCAGAGGGGG - Intronic
954736963 3:52714912-52714934 TAGAGCCCAAAGTCCGGAGGGGG - Intronic
955111948 3:55958652-55958674 CAGCACCCAAAGTCTAGAGAGGG + Intronic
955303760 3:57809431-57809453 CAGCACCCAAAGTCCAGAGTGGG - Intronic
956460695 3:69468809-69468831 CAGAACAGCAAGTCCAGAGGTGG - Intronic
957095260 3:75772007-75772029 CAGTGCCCAAAGTCTGGAGGGGG - Intronic
957136332 3:76294008-76294030 CGGCACCCAAAGTCCAGAGGGGG + Intronic
957417814 3:79929195-79929217 CAGTGCCCAAAGTGTGGAGGTGG - Intergenic
957614475 3:82509430-82509452 CGGCACTCAAAGTCCAGAGGGGG - Intergenic
959037419 3:101383691-101383713 TGGCCCCCAAAGTCCAGAGGGGG - Intronic
960333805 3:116392484-116392506 CAGTGCCCTAAGTCCAGAGGAGG - Intronic
960634292 3:119768322-119768344 CAGTGCCCAAAGACAGGAGGGGG + Intergenic
961525765 3:127496450-127496472 CAGTGCCCAAAGTCTGAAGGTGG - Intergenic
961985145 3:131124100-131124122 CAGTAACCAAACTCCAGAAAAGG + Intronic
962105294 3:132383138-132383160 CAGAGTCCAAAGTCCAGAGGGGG + Intergenic
962824598 3:139088759-139088781 CAGTGCCCAAAGTCTGGAGCGGG + Intronic
962944346 3:140153746-140153768 CATTACCCCAAGGCCTGAGGTGG - Intronic
963061313 3:141229516-141229538 CAGAACCCAGAGTCCACAGGGGG + Intronic
963250138 3:143095553-143095575 CAACACCCAAAGTCCAGAAGGGG - Intergenic
963560105 3:146854403-146854425 CATTACCCAAAGTGCAGAGAAGG + Intergenic
963805094 3:149714541-149714563 TAGTTCCCAAAGTCCAGAGAGGG - Intronic
964590777 3:158360587-158360609 TAGTGCCCAAAGTCTGGAGGGGG + Intronic
964996748 3:162891659-162891681 TGGCACCCAAAGTCCAGAAGGGG - Intergenic
965115004 3:164477606-164477628 TTGTGTCCAAAGTCCAGAGGGGG - Intergenic
965118677 3:164522375-164522397 TGGTGCCCAAAGTCCAGAGAGGG + Intergenic
965165927 3:165194645-165194667 GGGTACCCAATGTGCAGAGGCGG + Intronic
965367712 3:167820596-167820618 CAGTGCCCAAAGTCTGGAGGGGG - Intronic
966256050 3:177917705-177917727 CAGCACCCAATGTCTGGAGGGGG - Intergenic
966370212 3:179243755-179243777 CAGGAACCAAAGTCCAGGTGGGG - Intronic
1202741828 3_GL000221v1_random:63031-63053 CAGTTCCCAAAGTGTGGAGGGGG - Intergenic
968763534 4:2455984-2456006 CAGTGCCCAAAGTTCAGAGGAGG - Intronic
968980830 4:3848572-3848594 CAGTGCCCAAGGTCCAGAAGGGG + Intergenic
969194127 4:5547242-5547264 TGGTGTCCAAAGTCCAGAGGGGG - Intronic
969697378 4:8742246-8742268 CAGTAGCCAGAGCCCAGAGCAGG - Intergenic
972049060 4:34705256-34705278 CAAAACCCAAAGTCAACAGGAGG + Intergenic
972075212 4:35079054-35079076 CACTGCCCAAAGTCTGGAGGGGG - Intergenic
972106411 4:35494240-35494262 CAGGGCCCAAAGTCTGGAGGGGG - Intergenic
972158875 4:36198587-36198609 CAGGACCCAAAGTCCAGAGTGGG + Intronic
973041090 4:45471612-45471634 CAGTGCCCAAAGCTCAAAGGGGG - Intergenic
973398623 4:49618730-49618752 CACTGCCCAAAGTCTGGAGGGGG - Intergenic
973956303 4:56066745-56066767 CAGTACACAAAGTACAGGGAAGG + Intergenic
974619797 4:64340559-64340581 CAGTGCCCAAAGTCCAGAGGGGG - Intronic
974686874 4:65242316-65242338 CGGTGCCCGAAGTCCAGAGGGGG + Intergenic
975910221 4:79258530-79258552 CAGCACCCAAAGTCCAGAAGGGG - Intronic
976129633 4:81870759-81870781 CGGTGCCCAAAGTCTGGAGGGGG - Intronic
976700737 4:87966456-87966478 CAGTGCCCAAAGTCTGGAGGAGG - Intergenic
976734522 4:88296541-88296563 CAGCACCCAAAATCTGGAGGGGG + Intergenic
977410229 4:96653302-96653324 CAGCACCCAAAGCCTGGAGGGGG - Intergenic
978149415 4:105415369-105415391 CAGCGCCAAAAGTCCAGAGGGGG + Intronic
978184087 4:105836603-105836625 CAGTGCCCAAAGTCCAGAGGGGG + Intronic
978248619 4:106604517-106604539 TGGCACCCAAAGTCCAGAGGGGG + Intergenic
978498422 4:109384431-109384453 TGGTGCCCAAAGTCCAGAGTGGG - Intergenic
978663476 4:111154808-111154830 CAGTGCCCAAAATCTGGAGGGGG + Intergenic
978822334 4:112980128-112980150 CAGTGCCCAAAGTCCAAAGGGGG + Intronic
979956106 4:126955718-126955740 TGGCACCCAAAGTCCAGAGGGGG - Intergenic
980180174 4:129392560-129392582 CGGTGCCCAAAGTCCAAAGGGGG - Intergenic
980253673 4:130349598-130349620 CAGTGCCCAAAGTCCAGAAAAGG + Intergenic
980270151 4:130573923-130573945 TAGTACCAAAAGTCTAGAGAAGG - Intergenic
980282224 4:130736820-130736842 TGTTGCCCAAAGTCCAGAGGGGG - Intergenic
980306339 4:131065342-131065364 CAGGACCCAAAGTCCAGAGGGGG + Intergenic
980309084 4:131102449-131102471 CAGTGCCCAAAGTCTGAAGGGGG + Intergenic
980450091 4:132959056-132959078 TGGTGCCCAAAATCCAGAGGGGG - Intergenic
980544727 4:134244412-134244434 TGGTGCCCAAAGTCCATAGGGGG - Intergenic
980671096 4:136008457-136008479 TGGTGCCCAGAGTCCAGAGGGGG - Intergenic
980738219 4:136918012-136918034 TGGGAACCAAAGTCCAGAGGGGG - Intergenic
981727413 4:147862138-147862160 TGGCATCCAAAGTCCAGAGGGGG + Intronic
982181055 4:152748748-152748770 CGGTGCCCAAAGTCCGGAGGGGG - Intronic
982222704 4:153138418-153138440 CAGAACCCACAGGCCAGGGGTGG - Intergenic
982611001 4:157574640-157574662 CAGTGCCCAAAGTCTGGATGGGG - Intergenic
982856276 4:160385911-160385933 CAGCATCCAAAATCTAGAGGAGG + Intergenic
983069760 4:163254299-163254321 TGGTGCCCAAAGTCCAGAGGGGG + Intergenic
983125923 4:163950284-163950306 CAGTGCCCAAAGTCCAGAGGGGG + Intronic
983715377 4:170776136-170776158 CGGCACCCAAAGTCTAGAGGGGG - Intergenic
984102179 4:175499564-175499586 CAGCACCCAAAGTCTGGAGAGGG + Intergenic
984337788 4:178415208-178415230 CAGTGCCCAAAGTCCGGAGGGGG - Intergenic
985228580 4:187789616-187789638 TGACACCCAAAGTCCAGAGGGGG - Intergenic
1202759819 4_GL000008v2_random:99604-99626 CAGTGCCCAAAGTCTGGAGGGGG + Intergenic
986503927 5:8429940-8429962 CCGTTCCCAAAGTCCAGAGGGGG + Intergenic
988073805 5:26326295-26326317 CAGCACCCAAAGTCCGGCGGGGG + Intergenic
988081211 5:26417061-26417083 CAGCACCAGAAGTCCAGATGGGG + Intergenic
988093267 5:26569368-26569390 CAGTACCCAAAGTCTGGAGAGGG + Intergenic
988565973 5:32320359-32320381 CAGTACCCAAAGTCTGGAGGGGG + Intergenic
988845453 5:35122993-35123015 CAGTGCCCAAAGGTCAGGGGTGG + Intronic
990023685 5:51159791-51159813 CAGTGCCCAAAGTCCAAAGGGGG - Intergenic
990923531 5:60994075-60994097 TGGTGCCCAAAATCCAGAGGGGG + Intronic
991359353 5:65803364-65803386 CAGTGCCCAAAGTTCAGTAGGGG + Intronic
992703890 5:79368446-79368468 AAGTAGCCAAAGGCCAGAGCAGG - Intergenic
992838972 5:80668492-80668514 CAGTGTCCAAAGTCCAGAGGGGG + Intronic
993187116 5:84635390-84635412 CAGTGCCCAATGTCCAGACTGGG + Intergenic
994181785 5:96775680-96775702 CAGTTACCAAAATCCAGAGGTGG + Intronic
994692430 5:103034899-103034921 TAGCACCCAAAATCCAGAGGGGG + Intergenic
995386554 5:111595814-111595836 GTGTGCCCAAAGTCCAGATGGGG - Intergenic
995926962 5:117386227-117386249 CAGTGTCCAAAGTCTAGAGGGGG - Intergenic
996688348 5:126310003-126310025 CACTACCAAAAGCTCAGAGGTGG + Intergenic
997960394 5:138316345-138316367 CCGTGCCCAAATTCTAGAGGGGG - Intronic
998480586 5:142459476-142459498 CAGCACCCAAAGTCCAGAGGAGG + Intergenic
999315249 5:150579385-150579407 TGGTGCCCAAAGTCCAGAGGAGG - Intergenic
1001893827 5:175362007-175362029 CAGCATCCAAAGTCATGAGGAGG + Intergenic
1002536821 5:179880356-179880378 CAGAAAGCAAAGTCCAGTGGGGG + Intronic
1002669019 5:180850088-180850110 CAGGCCTCAAAGTCCACAGGAGG - Exonic
1002726539 5:181301274-181301296 CAGCACCCATAGTCCAGGCGTGG + Intergenic
1004105822 6:12667135-12667157 CAGTGGCAAAAGTACAGAGGAGG + Intergenic
1004720881 6:18266320-18266342 TGGTGCCCAAAGTCCAGAGAGGG + Intergenic
1005594671 6:27368053-27368075 CAGTGCCCAAAGTCTGGAGGGGG - Intergenic
1005775795 6:29129854-29129876 TGGTGCCCAAAGTCCAGAGCGGG - Intergenic
1005781882 6:29201372-29201394 TGGTGCCCAAAGCCCAGAGGGGG - Intergenic
1006333723 6:33410213-33410235 CGGACCCCAGAGTCCAGAGGCGG + Intergenic
1006463850 6:34179284-34179306 CAGCACCCAAAGTCTGGAGGGGG + Intergenic
1008037490 6:46761329-46761351 CATTTCCCTCAGTCCAGAGGGGG + Intergenic
1008231556 6:48989946-48989968 TGGCACCTAAAGTCCAGAGGGGG - Intergenic
1008330706 6:50240955-50240977 CAGTGCCCAAAATCCAGAGGGGG + Intergenic
1009530261 6:64803701-64803723 CAGTGCCCAAAATCTGGAGGGGG + Intronic
1009534357 6:64861221-64861243 TGGTGCCCAAAGTCCAGAGGGGG + Intronic
1009582828 6:65558258-65558280 CAGCACCCAAAGCCTGGAGGGGG + Intronic
1010559604 6:77333435-77333457 TGGCACCCAAAGTTCAGAGGGGG - Intergenic
1011326406 6:86153150-86153172 CACTACTCAGAGTCCAGAAGTGG - Intergenic
1011921001 6:92577284-92577306 CAGTGCAAACAGTCCAGAGGAGG + Intergenic
1011930202 6:92701602-92701624 TGGCACCCAAAGTCCAGACGGGG + Intergenic
1012052337 6:94361559-94361581 TGGTGCCCAAAATCCAGAGGGGG + Intergenic
1012100784 6:95083821-95083843 CAGAGCTCAAAGTCCAGAGAGGG - Intergenic
1012122325 6:95384247-95384269 CAGTGCCCAAAGTGTGGAGGGGG - Intergenic
1013086783 6:106864028-106864050 CAGTACCCAAAGACCAGAGGGGG + Intergenic
1014320937 6:119927228-119927250 CAGTTCCCAAGGTCCTGATGGGG - Intergenic
1014384668 6:120785925-120785947 CAGTGCCCAAAGTCCAGATGGGG - Intergenic
1014667927 6:124262282-124262304 AAGAGCCCAAAGTCCAGTGGGGG + Intronic
1014770427 6:125453201-125453223 CAGCACCCAAAGTCTGGAAGGGG - Intergenic
1015434675 6:133172393-133172415 CAGTGCCCAAAGCACAGAGGGGG - Intergenic
1015626942 6:135189040-135189062 CAGGAGCAAAAGCCCAGAGGAGG - Intronic
1015663661 6:135603467-135603489 CAGTGCCCAAAGTCTGGAGGGGG - Intergenic
1016076804 6:139805344-139805366 CGGTGCCCAAAGTCTGGAGGTGG + Intergenic
1016163372 6:140908456-140908478 CAGTGCCCAAAGTCTAGAGGGGG + Intergenic
1016199940 6:141394853-141394875 CGGTGGCCAAAGTCCAGAGTGGG - Intergenic
1016758908 6:147716207-147716229 CACCCCCCAAAGTCCAGAGGGGG + Intronic
1017054434 6:150424720-150424742 TGGCACCCAAAGTCCAGAGGGGG - Intergenic
1019932206 7:4231023-4231045 CAGTTCTCCAGGTCCAGAGGAGG + Intronic
1020761192 7:12269698-12269720 TGGTGCCCAAAGTCCAGAAGGGG - Intergenic
1021431199 7:20560462-20560484 TTGCACCCAAAGTCCAGAAGGGG + Intergenic
1022124204 7:27340113-27340135 CAGAACTCAAAGTCCAGAACGGG + Intergenic
1022423504 7:30246211-30246233 TGGCACCCAAAGTTCAGAGGGGG + Intergenic
1023345621 7:39268415-39268437 CAGTACATAAAGTACTGAGGCGG + Intronic
1023700085 7:42883742-42883764 CAGCACCCAAAGTCCACAGGGGG + Intergenic
1023879807 7:44312007-44312029 CTGTCCCCACAGCCCAGAGGGGG + Intronic
1024020450 7:45363488-45363510 CAGCACCCAAAGTTAAGAGAAGG - Intergenic
1024024514 7:45399526-45399548 CAGCGCCCAAAGTCTGGAGGAGG - Intergenic
1024584223 7:50827193-50827215 CAGTACCCAATGGCCAAAGCTGG - Intergenic
1026370235 7:69691453-69691475 TTGCAGCCAAAGTCCAGAGGGGG + Intronic
1027687446 7:81295081-81295103 CGGTGCCCAAAGTCGGGAGGGGG + Intergenic
1027779908 7:82507926-82507948 GAGTGCCCAAAGTCTGGAGGGGG + Intergenic
1027995739 7:85423726-85423748 CAGCACCCAAAGTCTGGAGGGGG - Intergenic
1028035187 7:85972705-85972727 CAGTGCCCAAAGTCCAGAGGGGG + Intergenic
1028053141 7:86208963-86208985 CAGCACCCAAAGTCTGGAGGGGG + Intergenic
1028136713 7:87230408-87230430 AGGCACCCAAAGTCTAGAGGGGG - Intergenic
1028527463 7:91801558-91801580 CAGTGCCCAAAGTCCAGAGGGGG + Intronic
1028596078 7:92547268-92547290 CAGTGCCCAAAGTCCGGAGGGGG - Intergenic
1028717063 7:93983057-93983079 CAGTACCAGAAGACCAGAGGTGG + Intronic
1029973827 7:104814727-104814749 CAGTGCCCAAATTCCAGAGGGGG + Intronic
1030296747 7:107936473-107936495 CAGAAACCAAAATCCACAGGTGG - Intronic
1030484570 7:110149437-110149459 CAGCACCCAAAATCCAGAGGGGG + Intergenic
1030514114 7:110519618-110519640 CAGCACTCAAAATCCGGAGGGGG + Intergenic
1030721887 7:112881208-112881230 CAGTGCCCAAAGTCTGGAGGGGG - Intronic
1030981157 7:116186531-116186553 TGGCACCCAAAGTCCAGAGGAGG + Intergenic
1031692353 7:124804619-124804641 CAGAACAAAAAGTCCAGAGGTGG + Intergenic
1031786516 7:126040681-126040703 CGGTGCCCAAAGTCCGGAGGGGG - Intergenic
1031837079 7:126691195-126691217 CAGTGCCCAAAGTCCAGAGGGGG + Intronic
1031859043 7:126957667-126957689 TGGTGCCCAAAGTCCAGAGGGGG - Intronic
1032591248 7:133194111-133194133 CAGCACCCAAACTCCAGAGGGGG + Intergenic
1032658382 7:133955767-133955789 CAGCACCCAAAGGCCAGAAGGGG + Intronic
1032858663 7:135858183-135858205 TGGTGCCTAAAGTCCAGAGGGGG + Intergenic
1033340038 7:140484794-140484816 CAGATGCCAGAGTCCAGAGGGGG + Intergenic
1033666344 7:143444266-143444288 CAGAATTTAAAGTCCAGAGGTGG - Exonic
1034210460 7:149358370-149358392 TGGTGCCCAAAGTCCAGAGGGGG + Intergenic
1034252235 7:149701692-149701714 CAGTGCCCAAAGTCTGGAGGGGG + Intergenic
1034713752 7:153220153-153220175 CCGTAGCCAGAGACCAGAGGGGG + Intergenic
1035252452 7:157606079-157606101 TGGTGCCCAAAGTCCAGAGGGGG + Intronic
1036676679 8:10839778-10839800 CAGTCACCCAGGTCCAGAGGCGG - Exonic
1036702915 8:11024988-11025010 CAGTAACCAAAGTCCACAGGAGG + Intronic
1036915507 8:12799927-12799949 TGGTGCCCAAAGTCCAGAGGGGG + Intergenic
1038149278 8:24928057-24928079 CAGCACCCAAAGTCTGGAGGGGG - Intergenic
1039771271 8:40689257-40689279 AAGTAGCCAGAGTCCACAGGTGG + Intronic
1040661780 8:49583031-49583053 CAGTGCTCAAAGTCTGGAGGGGG - Intergenic
1041205553 8:55495074-55495096 CAGTGCCCAAAGTCCAGAGCGGG + Intronic
1041956003 8:63558731-63558753 CAGTGTCCGAAGTCCAGAGGGGG - Intergenic
1042004875 8:64169251-64169273 CAGTGCCCAGAGTCCAGAAGGGG - Intergenic
1042196859 8:66238356-66238378 CAGTGCCCAAAGTACAGAGGGGG + Intergenic
1042608965 8:70577141-70577163 CAGCACCCAAAGTCCTGACAGGG - Intronic
1043082599 8:75784802-75784824 TGGTACCCAAAGTCCAGAGGGGG + Intergenic
1043533085 8:81171838-81171860 AGGTGCCCAAAGTCCAGAGGGGG + Intergenic
1043708094 8:83378413-83378435 TGGCACCCAAAGTCCAGAGGAGG + Intergenic
1043735063 8:83731135-83731157 CAGTGCCCAAAGTCTGGATGGGG + Intergenic
1043758065 8:84029573-84029595 CAGTGCCCAAAGTCTGGAGGGGG - Intergenic
1043758256 8:84031525-84031547 CAGTGCTCAAAGTCTGGAGGGGG - Intergenic
1044409486 8:91867977-91867999 CAGCACCCAAAGTCCAGAGGGGG - Intergenic
1044525016 8:93241825-93241847 CAGTGCCCGAAGTCCAGAGGGGG + Intergenic
1044650710 8:94491437-94491459 CAGTACCACTAGTCCAGAGGTGG + Intronic
1045887995 8:107122806-107122828 TGGCACCCAAAGTCCAGAGGGGG - Intergenic
1046013851 8:108582658-108582680 CAATAGGCAGAGTCCAGAGGTGG + Intergenic
1046026958 8:108736101-108736123 CAGTGCCAAAAGTCCAGCTGAGG - Intronic
1046395326 8:113632996-113633018 CAGCACCCAAAATCCAGAGGTGG + Intergenic
1046503805 8:115111716-115111738 TGGCACCCAAAGTCCAGAGGGGG + Intergenic
1046674721 8:117094867-117094889 TGGCACCCAAAGTCCAGAGGGGG + Intronic
1046921469 8:119733832-119733854 TAGTACCCATAATCCAGATGAGG - Intronic
1047104719 8:121720078-121720100 CAGCACCAAAAGCCCAGAGGGGG + Intergenic
1047318409 8:123755256-123755278 CAGTGTCCAAAGTCCAGAGGGGG + Intergenic
1048421757 8:134284308-134284330 TGGTGCCCAAAGTCCAGAGGGGG + Intergenic
1048693113 8:136989740-136989762 AGGTGCCCAAAGTCCAGAGGGGG + Intergenic
1049140437 8:140949628-140949650 CAGTGCCCAAAGTCTGGAGTGGG - Intronic
1049762075 8:144336277-144336299 CAGCATCCAAAGGCCAGAGTGGG - Exonic
1049826896 8:144674772-144674794 CGGCACCCAAAGTCCGAAGGCGG + Intergenic
1050118222 9:2282123-2282145 CAGAGCCCAAGGTGCAGAGGTGG - Intergenic
1050182279 9:2934250-2934272 CAGAGCCCAAAGTCTAGAGGAGG - Intergenic
1050191104 9:3027384-3027406 CAGGAACCAAAGTGAAGAGGAGG + Intergenic
1050483935 9:6114456-6114478 CAGTGCCCAAAGTCCAGAGGGGG - Intergenic
1051355117 9:16233937-16233959 TGGTGCCCAAAGTTCAGAGGGGG - Intronic
1052437093 9:28443677-28443699 TGGCACCCAAAGTCCAGAGGGGG - Intronic
1052580665 9:30350040-30350062 CTGTGCCCAAAGTCTAGAGGGGG + Intergenic
1052652431 9:31321545-31321567 CGGTGCCCAAAGTCCAGAAGAGG + Intergenic
1053231909 9:36417189-36417211 GAGTGCCCAAAGTGAAGAGGGGG - Intronic
1053303712 9:36969399-36969421 CAGAGCCCAAAGTTCAGAGAGGG + Intronic
1055816474 9:80212831-80212853 TGGCACCCAAAGTCCAGAGGAGG - Intergenic
1055890960 9:81122890-81122912 CAGCACCCAAAGTCAGGAGGGGG + Intergenic
1056462123 9:86818369-86818391 CAGTGCCCAAAGTCCAGATGGGG - Intergenic
1058270701 9:102968177-102968199 CAGCACCCAAAGTCTGGAGGGGG + Intergenic
1058510702 9:105713513-105713535 CAGCACCCAAAGTCCAGAGGGGG - Intronic
1058562807 9:106247579-106247601 CAGTGACCAAAGTCTAGAGATGG + Intergenic
1058935989 9:109770001-109770023 CAGTAACCCAAGCCCAGAGAGGG + Intronic
1060618777 9:125044159-125044181 CATTACCCAAAGTCTGGAGAGGG - Intronic
1060774971 9:126366304-126366326 CAGTAACCAAAGTAGAGATGAGG - Intronic
1061863013 9:133477596-133477618 CAGTTAGCAGAGTCCAGAGGGGG - Intronic
1062329076 9:136028928-136028950 CGGTGCCCAACATCCAGAGGGGG - Intronic
1203691606 Un_GL000214v1:47819-47841 CAGTGCCCAAAGTCTGGAGGGGG + Intergenic
1203751778 Un_GL000218v1:86986-87008 CAGTGCCCAAATTCTGGAGGGGG - Intergenic
1203540595 Un_KI270743v1:84499-84521 CAGTGCCCAAAGTCTGGAGGGGG + Intergenic
1203612384 Un_KI270749v1:21408-21430 CAGTGTTCAAAGTCCAGAAGGGG + Intergenic
1203644689 Un_KI270751v1:56372-56394 CAGTGCCCAAAGTCTGGAGGGGG - Intergenic
1185935927 X:4257254-4257276 CGGTGCCCAAAGTTCAGAAGTGG - Intergenic
1186223711 X:7375561-7375583 CAGTGCCTAAAGCCCAGAGGGGG + Intergenic
1187871290 X:23767110-23767132 CAGTGCCCAAAGCCTAGAGGGGG + Intergenic
1188756451 X:33969221-33969243 TGGTACCCAAAGTCTGGAGGGGG - Intergenic
1189083530 X:37997593-37997615 CAGAGCCCAAAGTCTGGAGGGGG - Intronic
1189856415 X:45229242-45229264 TGGTGCCCAAAGTCCAGAAGGGG + Intergenic
1190360610 X:49645141-49645163 CAGTGCCCAAAGTCTGGAGAGGG + Intergenic
1190369446 X:49727113-49727135 CAGCACCCAAAGTTTGGAGGGGG - Intergenic
1191016305 X:55813599-55813621 CGGCACCCAAAGTCCAGAGGGGG - Intergenic
1193108511 X:77704648-77704670 CAGTACCCAAAGTCCAGAGGGGG + Intronic
1193575069 X:83186160-83186182 TGGTGCCCAAAGTCTAGAGGTGG + Intergenic
1194621391 X:96176954-96176976 TAGTATCCCAAGCCCAGAGGTGG + Intergenic
1195375605 X:104224750-104224772 CAGAGCCCAAAGTCAAGAAGTGG + Intergenic
1195761213 X:108248416-108248438 CATAAACCAAAGTCCACAGGTGG - Intronic
1195880347 X:109586554-109586576 TGGCACCCAAAGTCCAAAGGGGG + Intergenic
1196530540 X:116781885-116781907 CAGTGCCCAAACTGCAGAAGTGG + Intergenic
1197342148 X:125287374-125287396 TGGCACCTAAAGTCCAGAGGGGG - Intergenic
1197783676 X:130180103-130180125 CATGACCCAAAGTACAGAGGAGG + Intronic
1197819866 X:130531623-130531645 CACTACCAAGATTCCAGAGGTGG - Intergenic
1197833453 X:130670192-130670214 CGGTAACCTAAGTCCACAGGAGG + Exonic
1198189431 X:134287881-134287903 TGGCACCCAAAGTCCAGAGGGGG - Intergenic
1199092274 X:143705781-143705803 CAGTGCCCAAAATTCAGAGGGGG - Intergenic
1199103743 X:143837706-143837728 CAGTGCCCAAAATCCAGAGGGGG - Intergenic
1199559422 X:149147066-149147088 CAGTTCCCAAAGTCCGGAGGGGG - Intergenic
1200032768 X:153309797-153309819 TTGCACCGAAAGTCCAGAGGAGG + Intergenic
1200138963 X:153888075-153888097 AGGTACCCAAGGTCCAGAGAGGG + Intronic
1200749200 Y:6929332-6929354 CAGTGCCCAAAGTCTGGAGGGGG + Intronic
1200822402 Y:7600253-7600275 CATTAGCCAAAGTGCAGAGAAGG - Intergenic
1201165433 Y:11204606-11204628 CAGTGCCCAAAGTCTGGAGGGGG - Intergenic
1201368514 Y:13235063-13235085 CAGTGCCCAAAGTTCAGAGTGGG + Intergenic
1201593217 Y:15637808-15637830 CAGTGCCTAAAGCCCAGAGGGGG + Intergenic
1202104409 Y:21347518-21347540 CATTAGCCAAAGTGCAGAGAAGG - Intergenic
1202237900 Y:22733764-22733786 CATTAGCCAAAGTGCAGAGAAGG + Intergenic