ID: 1114344485

View in Genome Browser
Species Human (GRCh38)
Location 14:21780952-21780974
Sequence ACAGTACCCAAAGTCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114344485_1114344500 28 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344500 14:21781003-21781025 GGCCAAGGGAAGCTTGGTGTGGG No data
1114344485_1114344491 -6 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344491 14:21780969-21780991 TACTGTTGAACATGGGAAGGAGG No data
1114344485_1114344498 22 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344498 14:21780997-21781019 AGTAGGGGCCAAGGGAAGCTTGG No data
1114344485_1114344497 14 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344497 14:21780989-21781011 AGGCTTGGAGTAGGGGCCAAGGG No data
1114344485_1114344493 5 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344493 14:21780980-21781002 ATGGGAAGGAGGCTTGGAGTAGG No data
1114344485_1114344492 -1 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344492 14:21780974-21780996 TTGAACATGGGAAGGAGGCTTGG No data
1114344485_1114344496 13 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344496 14:21780988-21781010 GAGGCTTGGAGTAGGGGCCAAGG No data
1114344485_1114344494 6 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344494 14:21780981-21781003 TGGGAAGGAGGCTTGGAGTAGGG No data
1114344485_1114344499 27 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344499 14:21781002-21781024 GGGCCAAGGGAAGCTTGGTGTGG No data
1114344485_1114344490 -9 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344490 14:21780966-21780988 GGGTACTGTTGAACATGGGAAGG No data
1114344485_1114344495 7 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344495 14:21780982-21781004 GGGAAGGAGGCTTGGAGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114344485 Original CRISPR ACAGTACCCAAAGTCCAGAG GGG (reversed) Intergenic
No off target data available for this crispr