ID: 1114344487

View in Genome Browser
Species Human (GRCh38)
Location 14:21780954-21780976
Sequence CAACAGTACCCAAAGTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114344487_1114344491 -8 Left 1114344487 14:21780954-21780976 CCTCTGGACTTTGGGTACTGTTG No data
Right 1114344491 14:21780969-21780991 TACTGTTGAACATGGGAAGGAGG No data
1114344487_1114344496 11 Left 1114344487 14:21780954-21780976 CCTCTGGACTTTGGGTACTGTTG No data
Right 1114344496 14:21780988-21781010 GAGGCTTGGAGTAGGGGCCAAGG No data
1114344487_1114344500 26 Left 1114344487 14:21780954-21780976 CCTCTGGACTTTGGGTACTGTTG No data
Right 1114344500 14:21781003-21781025 GGCCAAGGGAAGCTTGGTGTGGG No data
1114344487_1114344494 4 Left 1114344487 14:21780954-21780976 CCTCTGGACTTTGGGTACTGTTG No data
Right 1114344494 14:21780981-21781003 TGGGAAGGAGGCTTGGAGTAGGG No data
1114344487_1114344497 12 Left 1114344487 14:21780954-21780976 CCTCTGGACTTTGGGTACTGTTG No data
Right 1114344497 14:21780989-21781011 AGGCTTGGAGTAGGGGCCAAGGG No data
1114344487_1114344492 -3 Left 1114344487 14:21780954-21780976 CCTCTGGACTTTGGGTACTGTTG No data
Right 1114344492 14:21780974-21780996 TTGAACATGGGAAGGAGGCTTGG No data
1114344487_1114344493 3 Left 1114344487 14:21780954-21780976 CCTCTGGACTTTGGGTACTGTTG No data
Right 1114344493 14:21780980-21781002 ATGGGAAGGAGGCTTGGAGTAGG No data
1114344487_1114344498 20 Left 1114344487 14:21780954-21780976 CCTCTGGACTTTGGGTACTGTTG No data
Right 1114344498 14:21780997-21781019 AGTAGGGGCCAAGGGAAGCTTGG No data
1114344487_1114344495 5 Left 1114344487 14:21780954-21780976 CCTCTGGACTTTGGGTACTGTTG No data
Right 1114344495 14:21780982-21781004 GGGAAGGAGGCTTGGAGTAGGGG No data
1114344487_1114344499 25 Left 1114344487 14:21780954-21780976 CCTCTGGACTTTGGGTACTGTTG No data
Right 1114344499 14:21781002-21781024 GGGCCAAGGGAAGCTTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114344487 Original CRISPR CAACAGTACCCAAAGTCCAG AGG (reversed) Intergenic
No off target data available for this crispr