ID: 1114344500

View in Genome Browser
Species Human (GRCh38)
Location 14:21781003-21781025
Sequence GGCCAAGGGAAGCTTGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114344485_1114344500 28 Left 1114344485 14:21780952-21780974 CCCCTCTGGACTTTGGGTACTGT No data
Right 1114344500 14:21781003-21781025 GGCCAAGGGAAGCTTGGTGTGGG No data
1114344484_1114344500 29 Left 1114344484 14:21780951-21780973 CCCCCTCTGGACTTTGGGTACTG 0: 3
1: 31
2: 75
3: 183
4: 336
Right 1114344500 14:21781003-21781025 GGCCAAGGGAAGCTTGGTGTGGG No data
1114344486_1114344500 27 Left 1114344486 14:21780953-21780975 CCCTCTGGACTTTGGGTACTGTT No data
Right 1114344500 14:21781003-21781025 GGCCAAGGGAAGCTTGGTGTGGG No data
1114344487_1114344500 26 Left 1114344487 14:21780954-21780976 CCTCTGGACTTTGGGTACTGTTG No data
Right 1114344500 14:21781003-21781025 GGCCAAGGGAAGCTTGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114344500 Original CRISPR GGCCAAGGGAAGCTTGGTGT GGG Intergenic
No off target data available for this crispr