ID: 1114344748

View in Genome Browser
Species Human (GRCh38)
Location 14:21782591-21782613
Sequence GTTTTGCTCTGAGATAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114344744_1114344748 5 Left 1114344744 14:21782563-21782585 CCCATCTGCTCCATAATCACTGG No data
Right 1114344748 14:21782591-21782613 GTTTTGCTCTGAGATAGATCAGG No data
1114344747_1114344748 -5 Left 1114344747 14:21782573-21782595 CCATAATCACTGGTGATAGTTTT No data
Right 1114344748 14:21782591-21782613 GTTTTGCTCTGAGATAGATCAGG No data
1114344743_1114344748 22 Left 1114344743 14:21782546-21782568 CCAGTTCTTCTGTTTTGCCCATC No data
Right 1114344748 14:21782591-21782613 GTTTTGCTCTGAGATAGATCAGG No data
1114344746_1114344748 4 Left 1114344746 14:21782564-21782586 CCATCTGCTCCATAATCACTGGT No data
Right 1114344748 14:21782591-21782613 GTTTTGCTCTGAGATAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114344748 Original CRISPR GTTTTGCTCTGAGATAGATC AGG Intergenic
No off target data available for this crispr