ID: 1114344834

View in Genome Browser
Species Human (GRCh38)
Location 14:21783530-21783552
Sequence CTGTATCCAAACATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114344827_1114344834 24 Left 1114344827 14:21783483-21783505 CCTATTTCTGTGCTGTAGATGCA No data
Right 1114344834 14:21783530-21783552 CTGTATCCAAACATGCAGCTGGG No data
1114344829_1114344834 -6 Left 1114344829 14:21783513-21783535 CCCTAGGCACCTGCAACCTGTAT No data
Right 1114344834 14:21783530-21783552 CTGTATCCAAACATGCAGCTGGG No data
1114344830_1114344834 -7 Left 1114344830 14:21783514-21783536 CCTAGGCACCTGCAACCTGTATC No data
Right 1114344834 14:21783530-21783552 CTGTATCCAAACATGCAGCTGGG No data
1114344826_1114344834 27 Left 1114344826 14:21783480-21783502 CCACCTATTTCTGTGCTGTAGAT No data
Right 1114344834 14:21783530-21783552 CTGTATCCAAACATGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114344834 Original CRISPR CTGTATCCAAACATGCAGCT GGG Intergenic
No off target data available for this crispr