ID: 1114345099

View in Genome Browser
Species Human (GRCh38)
Location 14:21786530-21786552
Sequence AGGGAAACTGAATTCTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114345099_1114345103 7 Left 1114345099 14:21786530-21786552 CCAAGAGAGAATTCAGTTTCCCT No data
Right 1114345103 14:21786560-21786582 CCCTATTTAATCTAAATCCTTGG No data
1114345099_1114345105 21 Left 1114345099 14:21786530-21786552 CCAAGAGAGAATTCAGTTTCCCT No data
Right 1114345105 14:21786574-21786596 AATCCTTGGATTACAATTGTTGG No data
1114345099_1114345106 22 Left 1114345099 14:21786530-21786552 CCAAGAGAGAATTCAGTTTCCCT No data
Right 1114345106 14:21786575-21786597 ATCCTTGGATTACAATTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114345099 Original CRISPR AGGGAAACTGAATTCTCTCT TGG (reversed) Intergenic
No off target data available for this crispr