ID: 1114345100

View in Genome Browser
Species Human (GRCh38)
Location 14:21786549-21786571
Sequence GATTAAATAGGGTAAAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114345100_1114345106 3 Left 1114345100 14:21786549-21786571 CCCTGACTTTACCCTATTTAATC No data
Right 1114345106 14:21786575-21786597 ATCCTTGGATTACAATTGTTGGG No data
1114345100_1114345105 2 Left 1114345100 14:21786549-21786571 CCCTGACTTTACCCTATTTAATC No data
Right 1114345105 14:21786574-21786596 AATCCTTGGATTACAATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114345100 Original CRISPR GATTAAATAGGGTAAAGTCA GGG (reversed) Intergenic
No off target data available for this crispr