ID: 1114345106

View in Genome Browser
Species Human (GRCh38)
Location 14:21786575-21786597
Sequence ATCCTTGGATTACAATTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114345102_1114345106 -8 Left 1114345102 14:21786560-21786582 CCCTATTTAATCTAAATCCTTGG No data
Right 1114345106 14:21786575-21786597 ATCCTTGGATTACAATTGTTGGG No data
1114345104_1114345106 -9 Left 1114345104 14:21786561-21786583 CCTATTTAATCTAAATCCTTGGA No data
Right 1114345106 14:21786575-21786597 ATCCTTGGATTACAATTGTTGGG No data
1114345101_1114345106 2 Left 1114345101 14:21786550-21786572 CCTGACTTTACCCTATTTAATCT No data
Right 1114345106 14:21786575-21786597 ATCCTTGGATTACAATTGTTGGG No data
1114345099_1114345106 22 Left 1114345099 14:21786530-21786552 CCAAGAGAGAATTCAGTTTCCCT No data
Right 1114345106 14:21786575-21786597 ATCCTTGGATTACAATTGTTGGG No data
1114345100_1114345106 3 Left 1114345100 14:21786549-21786571 CCCTGACTTTACCCTATTTAATC No data
Right 1114345106 14:21786575-21786597 ATCCTTGGATTACAATTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114345106 Original CRISPR ATCCTTGGATTACAATTGTT GGG Intergenic
No off target data available for this crispr