ID: 1114345548

View in Genome Browser
Species Human (GRCh38)
Location 14:21790660-21790682
Sequence TCCCCAGGACAGTCTCATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114345546_1114345548 5 Left 1114345546 14:21790632-21790654 CCTGAGGGAACTTTTTAAAAACA No data
Right 1114345548 14:21790660-21790682 TCCCCAGGACAGTCTCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114345548 Original CRISPR TCCCCAGGACAGTCTCATAG AGG Intergenic
No off target data available for this crispr