ID: 1114350039

View in Genome Browser
Species Human (GRCh38)
Location 14:21840076-21840098
Sequence CTGTAGGCCAGCAATGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114350039_1114350041 -5 Left 1114350039 14:21840076-21840098 CCTGCATCATTGCTGGCCTACAG No data
Right 1114350041 14:21840094-21840116 TACAGCCACCAGCTTCTTCAAGG No data
1114350039_1114350046 24 Left 1114350039 14:21840076-21840098 CCTGCATCATTGCTGGCCTACAG No data
Right 1114350046 14:21840123-21840145 AGCAGATTATGGACTAGAGGAGG No data
1114350039_1114350045 21 Left 1114350039 14:21840076-21840098 CCTGCATCATTGCTGGCCTACAG No data
Right 1114350045 14:21840120-21840142 CAGAGCAGATTATGGACTAGAGG No data
1114350039_1114350044 13 Left 1114350039 14:21840076-21840098 CCTGCATCATTGCTGGCCTACAG No data
Right 1114350044 14:21840112-21840134 CAAGGACACAGAGCAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114350039 Original CRISPR CTGTAGGCCAGCAATGATGC AGG (reversed) Intergenic
No off target data available for this crispr