ID: 1114350589

View in Genome Browser
Species Human (GRCh38)
Location 14:21846447-21846469
Sequence CGTCGCCCCCTGGAGGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114350589_1114350594 -9 Left 1114350589 14:21846447-21846469 CCTGTGCCCTCCAGGGGGCGACG No data
Right 1114350594 14:21846461-21846483 GGGGCGACGTTGCACTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114350589 Original CRISPR CGTCGCCCCCTGGAGGGCAC AGG (reversed) Intergenic
No off target data available for this crispr