ID: 1114352299

View in Genome Browser
Species Human (GRCh38)
Location 14:21866447-21866469
Sequence GGAAACAATACGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114352299_1114352302 -4 Left 1114352299 14:21866447-21866469 CCTTCCTCCTTCGTATTGTTTCC No data
Right 1114352302 14:21866466-21866488 TTCCTCTGCCTCATTCCTGCAGG No data
1114352299_1114352307 26 Left 1114352299 14:21866447-21866469 CCTTCCTCCTTCGTATTGTTTCC No data
Right 1114352307 14:21866496-21866518 TGCTGAGCAAAGAGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114352299 Original CRISPR GGAAACAATACGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr