ID: 1114352302

View in Genome Browser
Species Human (GRCh38)
Location 14:21866466-21866488
Sequence TTCCTCTGCCTCATTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114352300_1114352302 -8 Left 1114352300 14:21866451-21866473 CCTCCTTCGTATTGTTTCCTCTG No data
Right 1114352302 14:21866466-21866488 TTCCTCTGCCTCATTCCTGCAGG No data
1114352296_1114352302 25 Left 1114352296 14:21866418-21866440 CCGGGAGTAGAAAGAAACTGGAT No data
Right 1114352302 14:21866466-21866488 TTCCTCTGCCTCATTCCTGCAGG No data
1114352299_1114352302 -4 Left 1114352299 14:21866447-21866469 CCTTCCTCCTTCGTATTGTTTCC No data
Right 1114352302 14:21866466-21866488 TTCCTCTGCCTCATTCCTGCAGG No data
1114352298_1114352302 -3 Left 1114352298 14:21866446-21866468 CCCTTCCTCCTTCGTATTGTTTC No data
Right 1114352302 14:21866466-21866488 TTCCTCTGCCTCATTCCTGCAGG No data
1114352297_1114352302 0 Left 1114352297 14:21866443-21866465 CCTCCCTTCCTCCTTCGTATTGT No data
Right 1114352302 14:21866466-21866488 TTCCTCTGCCTCATTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114352302 Original CRISPR TTCCTCTGCCTCATTCCTGC AGG Intergenic
No off target data available for this crispr