ID: 1114352307

View in Genome Browser
Species Human (GRCh38)
Location 14:21866496-21866518
Sequence TGCTGAGCAAAGAGAAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114352305_1114352307 -8 Left 1114352305 14:21866481-21866503 CCTGCAGGACCACATTGCTGAGC No data
Right 1114352307 14:21866496-21866518 TGCTGAGCAAAGAGAAACTGAGG No data
1114352298_1114352307 27 Left 1114352298 14:21866446-21866468 CCCTTCCTCCTTCGTATTGTTTC No data
Right 1114352307 14:21866496-21866518 TGCTGAGCAAAGAGAAACTGAGG No data
1114352304_1114352307 -1 Left 1114352304 14:21866474-21866496 CCTCATTCCTGCAGGACCACATT No data
Right 1114352307 14:21866496-21866518 TGCTGAGCAAAGAGAAACTGAGG No data
1114352303_1114352307 5 Left 1114352303 14:21866468-21866490 CCTCTGCCTCATTCCTGCAGGAC No data
Right 1114352307 14:21866496-21866518 TGCTGAGCAAAGAGAAACTGAGG No data
1114352297_1114352307 30 Left 1114352297 14:21866443-21866465 CCTCCCTTCCTCCTTCGTATTGT No data
Right 1114352307 14:21866496-21866518 TGCTGAGCAAAGAGAAACTGAGG No data
1114352301_1114352307 19 Left 1114352301 14:21866454-21866476 CCTTCGTATTGTTTCCTCTGCCT No data
Right 1114352307 14:21866496-21866518 TGCTGAGCAAAGAGAAACTGAGG No data
1114352300_1114352307 22 Left 1114352300 14:21866451-21866473 CCTCCTTCGTATTGTTTCCTCTG No data
Right 1114352307 14:21866496-21866518 TGCTGAGCAAAGAGAAACTGAGG No data
1114352299_1114352307 26 Left 1114352299 14:21866447-21866469 CCTTCCTCCTTCGTATTGTTTCC No data
Right 1114352307 14:21866496-21866518 TGCTGAGCAAAGAGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114352307 Original CRISPR TGCTGAGCAAAGAGAAACTG AGG Intergenic
No off target data available for this crispr