ID: 1114353305

View in Genome Browser
Species Human (GRCh38)
Location 14:21878577-21878599
Sequence TCACTTCTGTTTGGAGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114353305_1114353308 24 Left 1114353305 14:21878577-21878599 CCTCTGTCTCCAAACAGAAGTGA No data
Right 1114353308 14:21878624-21878646 GTGAAGAAGCTGAATTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114353305 Original CRISPR TCACTTCTGTTTGGAGACAG AGG (reversed) Intergenic
No off target data available for this crispr